Skip to main content.
Tenemos los mejores juegos gratis online. Hannah Montana, Jonas brothers, Selena Gomez, Demi Lovato, Ben 10, Yugi oh y más.

Miley Cyrus, Selena Gomez o Demi Lovato? Cuál es la mejor?

Ellas son actrices, cantantes, famosas y millonarias... Cuál de ellas es tu favorita?

Who you like the most?

-- Resultados de la encuesta --

Y como este es un blog de juegos, aquí les dejo algunos juego que encontré:

Juegos de Demi Lovato
Juegos de Hanna Montana - Miley Cyrus
Juegos de Selena Gomez

Demi Lovato

Image and video hosting by TinyPic
Demi Lovato es conocida interpretando a Mitchie Torres en la película de Disney Channel Camp Rock junto a los jonas brothers. Ella también tiene su propia serie llamada Sunny entre Estrellas. Además de ser actriz, ella también es una talentosa cantante.

Selena Gomez

Image and video hosting by TinyPic
Selena Gomez es popular gracias a su papel en la serie de Disney Los Hechizeros de Weverly Place. También ha hecho películas exitosas como "Otra historia de una cenicienta" y "Programa de Protección para Princesas".

Miley Cyrus

Image and video hosting by TinyPic
Miley Cyrus es la protagonista de la popular serie Hannah Montana. Además, es una de las cantantes Pop más exitosas del momento.

Deja tu comentario y apoya a tu favorita!!!

item rate
Total de Votos: 3308 - Rating: 3.05

Vota por este artículo:

Ingrese su correo electrónico para suscribirse a los comentarios de este artículo:

Ingrese los caracteres de la imagen y presione el botón "Suscribirse":


selena gomez es mi idola miley cruz ermosa y demi lovato regalemen una limosina uruguay vivo en la huella ruta 48 km 19500 mi tel:3644157

Publicado por yanina at 14/10/09 12:10:38

Selena lo mejor!

Publicado por geral at 14/10/09 21:06:18

hola hannna en realidad yo se que te llamas destini ope cirus bueno bamos a lo importante yo soy melani y te estube inbestigando por internet quiero hacerte una entrevista respondeme bai

Publicado por melani at 15/10/09 09:08:57

selena eres la mejor me gusta como atuas de alex en los magos de waverly place sabes que me veo los magos de waverly place todos los dias soy tu numero uno de fan

Publicado por valentina at 17/10/09 16:31:08

selena:ss l mejor.m gusta t personaje en ls hechiceros d waverly place,la peli esta re buena es hermosa m gusta t personaje xq despues d haber echo ese echiso isiste l imposible para remediarlo...sos LO MAS!!!

miley:m gusta cm haces el personaje en hannah montana,la peli esta lo mas

demi:m gusta t personaje en sony entre estrellas tambien cm cantas

Publicado por ª! ·$%&/() at 19/10/09 17:05:20

selena:ss l mejor.m gusta t personaje en ls hechiceros d waverly place,la peli esta re buena es hermosa m gusta t personaje xq despues d haber echo ese echiso isiste l imposible para remediarlo...sos LO MAS!!!


Publicado por mayra at 19/10/09 17:08:56

hola demi lovato, selena gomez y maily cyrus yo me llamo tatiana

Publicado por tatiana at 22/10/09 10:30:00

hola soy tati y soy su gran almiradora e
y mi amiga agustina tambirnlas queremos mucho...








Publicado por tatiana at 22/10/09 10:38:08

hannah miro siempre tu cerie y nunca me la pierdo

Publicado por lucia at 22/10/09 14:23:45


Publicado por rubi at 23/10/09 17:21:35

nose las tres soys estupendas os elijo a las tre a ti selena a ti demi y a ti hannah

Publicado por Lucia at 24/10/09 06:42:08

las tres son estupendas y las quiero mucho chauuuuu

Publicado por candela at 24/10/09 10:02:50

hola soy valeria de colombia soy fans de ustedes quisiera conoserlos en persona espesial mente a ti mik eres el mas lindo de todos te quiero

Publicado por valeria at 24/10/09 20:26:17

ola me encantan las 3 kero ke ya no tiene ke a ver rivalidad entre ella la 3 son muy talentosas'''''' tkm miley cyrus y tam bien a emi y sel]]]*****

Publicado por hannah at 25/10/09 17:56:17

hola voto por demi me parese que es jenial y canta super bien

Publicado por chabeli at 26/10/09 16:26:42


Publicado por angie tatiana at 27/10/09 14:19:15

te amo hannah montana soy tu fans

Publicado por javiera at 27/10/09 18:51:49

la mejor es demi lovato y selena gomez miley se quedara afuera ja ja la amo a las dos las amo

Publicado por juli at 30/10/09 15:24:11

hola me llamo estephany hannah ,demi selena son mejores que todos los otros artistas y tambien me gusta ver hannah montana ,los hechiseros de warbely place y camp Rock pero el que mas me gusta es los hechiseros de werbely place la pelicula ados.

Publicado por estephany at 05/11/09 20:15:51

hola las adoro demi:soy tu mas granda fans ¿como podes actuar en 5 programas? seguro te cansas y si pudiera te ayudaria chau hannah:me encanta tu vos es increible que suerte queno tenes que aguantar a robi rey ni a jakson estuar en la vida real selena:vos sos divina y super genial mis amigas te apoyan y mucho igual que yo sos lo mas igual que hanna y demi

Publicado por sabrina at 05/11/09 21:57:07

demi hannah y selena lo mas!!!!!

Publicado por yazmin at 05/11/09 22:19:17

te quiero miley esres la mejor me ixe fan tuya por hananh te adoro despues ati sele y demi TE ODIO hananh es la mejor pork gano la encuesta con diferencia a demi y selena hannah la mejor

Publicado por marta at 06/11/09 11:10:28

hananh es la mejor con diferencia , por eso gano la encuesta , despues sele y demi apestas miley i love

Publicado por elia at 06/11/09 11:14:15

eres la mejor selena gomez te admiro mucho y creo que tu y violata isfel osea antonella se llavarian super bien tqm escribeme besos bay nena hermosa

Publicado por violeta at 06/11/09 14:30:22

ola las tres sois guapas

para selena:hay un amigo mio que te quieremucho

para demi lovato:hay una amiga mia que es fan tuya

para miley cyrus:soy tu mejor fan y besos a ti i a tu ermano y ermana

Publicado por judith at 06/11/09 15:30:45

selena es la mejor

es super mega imper hermosa

te adoro selena gomez

Publicado por dnnnnddd at 07/11/09 11:14:21

selena es la mejor y miley apesta y es una tonta y fea te amamos selena de viri y anna

Publicado por viridiana at 07/11/09 13:57:12

demi es la mejor cool k-pa

Publicado por sofy at 07/11/09 15:25:09

hannah eres la mejor, soy tu fan numero una .
te adoro eres la mejor ha una cosa no te separes nunca de tus amigas demi lovato y selena gomez porke son las mejores amigas ke una persona puede tener
hasta me he hecho un correeo con tu nombre

Publicado por estefany at 07/11/09 15:39:00

demi soy tu fan y hannah tambien soy tu fan pero soy mas ultra mega fan de selena gomez las admiro mucho a las 3 pero creo k ha selena la admiro mas

Publicado por candimariel at 07/11/09 19:38:02

hola como estan soy la fan de ustedes con mucho cariño flor

Publicado por flor de maria elizabeht at 08/11/09 21:32:43

hola hannah soy flor y soy fan tuya ,selena,demi son grandiosas de verda con mucho cariño

Publicado por flor de maria elizabeht at 08/11/09 21:36:43

me gusta demi lovato, canta super bn pero tambien me gusta miley cyrus y selena gomez todas son muy lindas y cantan super lindo pero en especial es selena gomez por q me facina su papel en los eciseros de waberly place,hola selena soy daniela y soy fan tuya besos atte dani muaaaa

Publicado por at 09/11/09 11:34:12

selena are the best

Publicado por estela at 10/11/09 11:50:55 ana demi la peli que hiciste con selena muy linda. su san anitaaaaa!!!!!

Publicado por ana at 11/11/09 10:16:31

yo voto por las tres hanna o myley
por que me gusta su musica y sus ojos y su forma de vestir ha y tamien me gusta su caricatura telenovela y de demi lovato me gusta camp rock y en esta foto hanna se ve muy niña no como otras mejores demi te ves la mejor en esta foto y me gusta las caris telenovelas
y de selena me gustan sus popderes y la de hechiceros de werbeerly place y enesta foto selena no te vez muy muy muy muy muy muy muy muy muy muy muy muy muy muy muy muy muy mu7y muy bien
las adoro

Publicado por marifer at 11/11/09 18:32:58

hola hanna montana

Publicado por antonella at 11/11/09 22:42:57

hhana no me gusta ahora me gusta selena gomez es ree linda la amo es mejor que mailey y demi(s)

Publicado por sabrina at 12/11/09 11:05:30

selena eres la mejor me gusta tu mucica tienes muchos que te queremos eres la mejor

Publicado por chiqui at 13/11/09 14:06:20

no se las tres son super bellas soy su almiradora las quiero chaitoo

Publicado por CHIQUI at 13/11/09 14:09:32

hola hami me gusta selena porque es la mejor

cha ote quiere scarlett

Publicado por scarlett at 14/11/09 14:18:35

puues para mee
selena gomez es la mejor de las 3
es super
aparte miley es una celosa burlona criticona ennvidiosa i todo lo demas
q se le pueda desir a esa ...!!

la vdd
es lo q digo
igual demi
osea ella es super igual que seleeenaa
pero miley no pasa para nda
como actriz es super me encanta hanna pero como persona es una poopo!!!
lo siento pero digo lo q es ii todos lo saven
asi q bae
las amoo
miley :(

Publicado por luz:) at 14/11/09 19:23:48

son jeniales todas 3 guau

Publicado por masherly at 17/11/09 14:50:02

hay pues las tres son geniales y yo voto por las 3 cada una como es en realidad es maravillosa porque tenemos qe votar solo por una si las tres son geniales

Publicado por VANESA at 17/11/09 22:40:56

hola hannah bueno miley como estas me llamo gailck soy una fan tuya y tengo 8 años queria saber como ser como tu quiero ser como tu y soy de venezuela bueno chao TQM

Publicado por GAILCK at 18/11/09 08:29:29


Publicado por GAILCK at 18/11/09 08:36:57

hola hannah selena y dami quiero que vengan a mi cumple sus dueños las degan voy a cumplir 9 años soy la fan numero 1 de ustedes las amo y sigan trabajando asi quieren chatear con migo mi e-mail es gracia por todo?????

Publicado por camila perrone at 18/11/09 12:37:16

hola selena hana y demi las amo y sigan asi trabajando divertidi selena mendale un beso a yostin y a macs hana a tu papa y a tu hermano demi a todos tus compañeros gracias.....

Publicado por camila at 18/11/09 12:41:56

selena eres realmente la mejor y tambien demi , la unica q no me cae es hanna q es una fea y gorda besos cariño

Publicado por claudi gerbie at 18/11/09 18:41:48

voto por demi!!
me gusta muxo su serie y sus canciones!!!!!

Publicado por cintya at 19/11/09 19:28:10


Publicado por VICKY STEFY at 20/11/09 08:54:46

hola a mi m gusta selena gomez xq m gusta su modo y su forma d vstir!!.....ES LA MJOR

Publicado por karo at 20/11/09 14:50:13

hola demi lovato es la mejor canta muy bien y selena gomez igual y son super guapas son las mejores me gustan mas ellas q miley cirus. demi lovato selena gomez las mejores

Publicado por elisabet at 21/11/09 06:13:01

a mi me gusta demi lovato la mejor es ella yo soy adela

Publicado por adela gauseno at 21/11/09 17:15:40

hay pues las tres son geniales y yo voto por las 3 cada una como es en realidad es maravillosa porque tenemos qe votar solo por una si las tres son geniales

Publicado por alisson navarro at 21/11/09 17:24:21

demi lovato es la mejor porque actua super bien canta fantastico y es muy muy bonita ademas su forma de ser es espectacular

Publicado por angie paola jimenez rodriguez at 21/11/09 21:27:28

hola me llamo fede me re gusta selena gomez es re linda le mando un beso...

Publicado por federico at 21/11/09 22:11:07

hola mari y les quiero decir que ya no se esten peleando porque todas son mis favoritas como decearia estar junto a ustedes 3 para que me den un autografo y quiero decirle que todos los dias veo disnep chanel y si fuera posible quiero que me manden un autografo soy de panamà les deseo buena suerte a las 3 besos adios.

Publicado por maria at 22/11/09 08:28:29

demi es lo + me encanta como canta , se4lena es re bonita y divertida y miley es tonta y fea

Publicado por aldana at 22/11/09 10:47:43

hola... selena me encanta la peli de los echiceros esta buenisima

Publicado por aldana at 22/11/09 10:51:14

ww es increible mily sirus pero como q no me gusto du imagen uuuuufffff _____--___-__--_---- DeMiLoVtO Es MuY OrIBLe Ose Y saBEn qIEN Es lA q GnO oBIo sElEnA gOmEsUUUUU QIERO MANDARLE SALUDOS PORQ Es mUY bEllA t qIeRO oJlA t PdiEra CoNoSeR BiE t Qiero

Publicado por yessenia at 22/11/09 17:12:51

hOlA qUe TaL HeEeE dE hEcHo lAs 3 mE eNcAnTaN pErO siempre tEnGo mI fAvOrItA mI fAvOrIta eS hAnNaH bUeNo

Publicado por Luji at 23/11/09 06:10:15

a la que dejo el primer comentario:vos seras la vabosa por que selena es muy considerada no anda haciendole burla a la tal miley cyrus y por cierto miley cyrus es una estupidaaaa en cambio selena y demi son lo maxxxxximooooo choo que te valla bien
sos una loca fijate las fotos porno que se saco tu queridisima miley cyrus ja ja ja imvecil anda a hablar mal de tu abuela

Publicado por anoma at 23/11/09 19:43:15

ola selena como estas tu eres mi cantante favoritaaaaa te quiero mucho tu tkm selena tu tambien miley te quiero mucho a y tu demi tambien te quiero a la q mas quiero en a selena por q es muy bonita poreso jajajaj bye q les valla bn en su carrera de cantante y sacen mas canciones lindas y nuevas jaja mmmmm un beso para la tres bye ajjajaj te quiero selena, miley,demi bye bye bye las quiero a las tres bastante ahah

Publicado por nuria at 24/11/09 14:07:38


Publicado por Aitana at 25/11/09 06:51:08


Publicado por Aitana at 25/11/09 06:54:19

hannah es la mejor canta jenial te adoro

Publicado por alisson at 25/11/09 08:14:26

demi: sos la mejor te quiero ,sele:adoro tu cancion magic y fallin down y miley me gusta tu forma de vestir sos preciosa

Publicado por vanesa at 25/11/09 11:13:01

bueno sin palabras el la mejor cantante del mundo

Publicado por hannia at 27/11/09 10:48:31


Publicado por SILVIA ROMÁN OMS at 27/11/09 13:17:07

Todos en sus comentarios tienen pésima ortografía.
Yo voto por Miley Cyrus, odio a Selena Gomez y Demi Lovato es mejor que Selena pero nadie es mejor que Miley.

Publicado por Samantha at 28/11/09 16:51:41

hola me llamo micaela a mi me parese q las tres son jeneales pero me quedo con selena y demi porq son:divertidas cantan re bien son muy lindas yo igual vote por selena besoss y selena soy tu fans numero 1 besoss chau

Publicado por micaela at 28/11/09 22:06:41

hola maylie como estas espero k bien eres rebonita y me encanta como cantas, hola demi lovato eres rebonita y me encanta como actuas,hola selena gomez como estas tu eres una actriz rebonita y me gusta como actuas en los echiseros
bueno sigan asi y veras k alcanzaran sus sueños y lo k siempre han logrago

Publicado por ana maria at 29/11/09 09:54:24

Hola me llamo pilar vivo en paysandume me encanta tu cerie demi dale este men a nico desile q es muy guapo y bonito hojala pudiera berlo y desirle muchas cosas tengo 15 años por que solo puedo estar empas por que mi amigas estan en en el otro correoy luego les disen a mi vieja

Publicado por pilar fernandez at 30/11/09 15:51:22

las quiero mucho a todas muak quiero hacer amigas de ustedes

Publicado por valentina at 30/11/09 18:42:12

yo tengo 13 anos y me agradan muchisimo las quiero mucho quiero que sean mis amigas porfiss

Publicado por valentina at 30/11/09 18:45:34

hola demi y selena y hana las quiero mucho cantan super lindo y soy su fans numero 1111 leanlo bien bueno muak

Publicado por valentina at 30/11/09 18:52:09

k chidoO

las keremos tantoO
demi,sel y miley

Publicado por diana at 01/12/09 23:20:25

hola me llamo miley y me encanta miley cirus , selena gomez y demi lovato son las mejores besos a los jonas los quierooooo chauuuuu

Publicado por miley antonella at 02/12/09 11:34:30

hola soy fabianna y me gusta muchisimo selena
gomez y es tan bella y yo boy a ser cantante y tengo 6 años.

Publicado por fabianna at 03/12/09 12:27:16


Publicado por FABIANNA at 03/12/09 12:44:20

las tres son lo max y son super hermosas

Publicado por natalia at 04/12/09 09:54:50

hola soy sofia y me gusta hanna es la mejor sele eres super linda y me gista como actuas en la serie los hechiseros de waryly place y demi me gustas como cantas PERO LA MEJOR DE TODAS ES HANNA DESPUES SELE Y DE ULTIMO DEMI y la mas bonita de todas es sele las adorobesos a todos y las quiero conoser besos chauuuuu

Publicado por sofia at 04/12/09 13:28:37

selena me ds un consego me gusta un chico que ago para invitarlo slir soy jeni hola soy aixa me quiero quedar en la casa de jeni y meli como ago para de cirle a mi mama como ago demi lovato besos para todas ls famosas que adoro como vosssss hola hanna montana quiero desirte que guardes este secreto yo meli te envio un secreto de mi novio que el gust de mi besos

Publicado por jeni,tuty y meli at 04/12/09 22:09:10

a mi me gustan las tres porque son lindas famosasss bellas prfesionales cantando y bailando son unas actrises profesionaleeee

Publicado por candee at 05/12/09 13:20:47

hola soy marife y me gusta hanna es la mejor sele eres super linda y me gista como actuas en la serie los hechiseros de waryly place y demi me gustas como cantas PERO LA MEJOR DE TODAS ES HANNA DESPUES SELE Y DE ULTIMO DEMI y la mas bonita de todas es sele las adorobesos a todos y las quiero conoser besos
selena me gusta un chico que ago para invitarlo slir soy marife

te quiero

Publicado por marife at 05/12/09 15:15:15

hola seena gomes y demi lovato
y escuche este chiste
chauuuuu mailey sailus aaa y me
llamo Karen ay
tengo 4562847618764515 ese año vey chauuuuu

Publicado por maria jose at 05/12/09 22:01:43

Miley es la mejor Selena y demi no van a poder con tigo votare un millon de beses por ti Y LOVE YOU Miley.

Publicado por Michael Mendoza at 06/12/09 12:10:43

selena es la mejor del mundo adolecente duela quien le deula y des pues sigue demi las dos son lo mejor del mundo.....

Publicado por editha at 06/12/09 16:03:36

hola selena eres bonita, talentosa,famosay eres muchas cosas mas que si lo digo aqui no me va a alcanzar el espacio mi primo dice que tu eres la mejor y dice que eres mejor que miley cirus y mejor que demi lovato dice que el es tu fan numero 1 te quierooooo, muchooooo, besooooos y abrazooooos .

Publicado por Daniela Mena at 07/12/09 14:46:16

hannah montana sos mi idola te re quiero y mi sueño es conoserte porfi veni a montevideo asi te puedo ver tengo todo de vos celena y demi tamvien las quiero pero a vos mas te re quiero besos responde y como ya te dige vani a montevideo

Publicado por natalia at 08/12/09 08:01:14

miren la verdad no xq razon pusieron esta tonta pagina xq si isieron una apuesta es la apuestac mas tonta ustedes ya saben q las 3son las mejores las kiero aunque no las conosca bay besos.

Publicado por katherin at 08/12/09 11:17:52

hola demi y selena son muy guapas y me gusta como actuan las amo y q algun dia vengan a españa bye las quiero y a nick de los jonas brother bye un besote a todos bye

Publicado por xiomara at 08/12/09 14:41:46

hola todas son mis cantantes faboritas pero yo escojo a demi por q me encanta todas sus canciones iguales a las de miley y selena pero lastimosamente me gusta mas demi lovato osea y tampoco se para q ponen eas preguntas tan bobas si 3 son las mejores aparte de los jonas brothers

Publicado por yuliana at 08/12/09 22:07:51

demi lovato eres la mejor tu musica me encanta y tu serie tambien bye ctm besos.

Publicado por estefany aracely at 11/12/09 23:39:09

demi lovato eres la mejor cantas ermoso y tu serie me encanta ojala algun dia vengas a peru y asi te pudiera conocer bye cdtm.

Publicado por estefany araceli at 11/12/09 23:43:48

Selena Gomes :sos lo mas,ojala cuando sea grande sea como vos :inteligente,por supuesto bella como vos,etc.

ojala algun dia vengas a FORMOSA a si te puedo conocer!!! voy a estar re feliz... no me voy a olvidar nunca ese dia si venis: !!!! :)

selena me extra, super,contra ,gusta tus canciones en especial la cancion llamada MAGIC!!!!


no te olvides qe soy tu fan N"1!!!!

ttttteeeee rrrerrerererererrerererrereerererrreereereree contra


:) :) :) :) :) :) :)

Publicado por yenifer at 12/12/09 10:42:31

SELENA GOMEZ:eres lo mejor .sigue asi!!!

firma:tu fan N"1

Publicado por fernanda at 12/12/09 11:32:26

selena gomez es la mejor al igual k demi lovato miley tambien era mi artista favorita pero sse convirtio en una robanovios y sexosa k ya no me gusta mucho xk es una mala influencia en cambio selena gomez y demi lovato
son las mejores !!!!! arriba selena y demi !!!!! arriba

Publicado por seledemi at 13/12/09 01:23:22

demi lovato es la mejor de sunny entre estrellas . myley cirus es k actua mas o menos por ke en hanna montana no kiere al yeick pero si todos la kieren y ke puedo desir de selena gomez ella y demi son las mejores amigas pork en programa de protecsion para prinsesas ellas no se kieren i al final la demi lovato le da suu corona a la selena gomez y asi demii y selena se ahen amigas las kiero muxo
i love you baby demi t.q.m selena t.q.m

Publicado por jessica at 13/12/09 11:02:31

demi lovato es la mejor ke aiga conocido en la vida para chatear con ustedes agregen esste contacto

Publicado por alejandra at 13/12/09 11:08:44

la mejor es demi por como canta pero luego la mas guapa es hannah pero selena tiene 1 pelo mu bonito xd

Publicado por marina lovato at 13/12/09 16:12:26


Publicado por agustina at 14/12/09 06:55:08

demi: en verdad,me gusta tu programa de sunny,entre estrellas

selena:sos la mas apreciada-por mi,claro-y la mas bonita

miley:lo que dice tu comentaria seledemi esta mal no sos robanovios ni sexosa no se que quiere decir sexosa te mando muuuuuchiiiiisimos besitos

Publicado por vane!!!!!!!!!!! at 14/12/09 11:15:38

pues a mi siempre elijo a miely cyrus obivio y por su puesto la verdadm ella tiene bastante os muy linda y tiene bastante extito en todo la verdad le va a ir bien en todo
demi es muy linda , pero mi no me convense aunqe debo amitirlo canta hermoso
selena tiene su voz pero no le veo lo lindo me gustan sus canciones pero repite todoo lo mismoo oh oh oh is magic y. todo asi tambn con fallind dow

Publicado por aixa at 14/12/09 14:26:56

demi lovato eres la mejor

Publicado por maria angelica at 14/12/09 22:32:16

demi sele y miley son las mejores porque siempre veo todos sus programas y series ademas de eso me inspiran con sus canciones parece que ... quiero tener un novio y besarlo jaja bueno besos y besitos

Publicado por vane at 16/12/09 14:35:13

mi favorita es hannah es muy linda y tiene una voz ermosa^^ despues demi porke es wapa y tiene una voz poetente y selena... sin comentarios 0.0

Publicado por leire at 16/12/09 15:21:59

eres vonita me justa cualdo ase la vagia
yo soy la mejor fan tuya

Publicado por mayerlin at 16/12/09 18:26:55

moto selena gomes la amo es la mejor de las que estan ay y la quiro conocer y jana atua mas omenos y demilobato es ba omenitos

Publicado por mayerlin at 16/12/09 18:35:50

a mi mer gusta selena pero tambien hannah y demi,yo pienso que las tres son geniales y digo que deven ser amigas y que no deverian peliarse por un tonto comentario de verdad ustedes se ven que se quieren unque tenga problemas de verian seguir mi consejo si de verdad quieren ser amigas no dejen que por un tonto comentario se acave su amistad las quiero besos y mi nombre es guadalupe y soy su fans numero 1

Publicado por guadalupe at 17/12/09 14:56:09

hola meencantas las 3 son buenas hanna eres bellisima y selena estas bellay levi tu tambien besos bay escribanme

Publicado por mabel nuñez at 18/12/09 11:59:13

miley es lomejor

Publicado por jasmi at 18/12/09 18:53:12

selena gomez sos la mejor
gana vz

Publicado por chofiitah at 19/12/09 13:02:09

demi es la mejor acique callence xfabor gracias

Publicado por julieta at 19/12/09 14:09:26

ke es mejor
selena gomez
ke les pasa
se cuida
se les kiere
y despues de selena es:
miley cirus

Publicado por brenda at 20/12/09 20:41:56

para mi la mejor es miley selena es una q se quiere pareser a miley igual demi

Publicado por isabel at 21/12/09 13:55:16

ami me gustan
las 3 tres
x k cantan
bien chido
asi k no jusgen
a ninguna de las
3 tres okkk

Publicado por maria d jesus at 21/12/09 18:03:06

yo las quiero a selena gomez y a demi lovato a miley no tanto pero las 3 son las mejores selena te adoro mucho demi a vos te adoro tambien maile cambia un poco se mas buena con las 2 besos

Publicado por milagros at 22/12/09 13:28:51

hay por favor las 3 son super estupendas ok no las jusguen oooook

Publicado por gianella at 22/12/09 15:25:00

demi y selena son dos angeles y miley es un diablo

Publicado por karla at 22/12/09 18:49:01

hola soy sofia me encanta como sale demi se ve chip no como el estilo gotico que andatrallendo aora yo soy fan numero1 se miley cyrus

Publicado por sofia at 22/12/09 21:19:41


Publicado por agustina at 23/12/09 09:00:34

Selena és lo + del momento

és realmente hermosa

Publicado por Anonima at 23/12/09 11:33:34

ola miley sos la mejor cantante pop te aoro yo quisiera ser como vos aora practico gitarra a sique pronto sere como vos

Publicado por tamaar at 23/12/09 12:36:02

hola selena tu eres la mejor ovio.

Publicado por oscar brando at 23/12/09 17:02:57

hola demi y miley son las peores cantan horrible.

Publicado por selena gomez at 23/12/09 17:05:39

yo voto por las tres ya que trabajan juntas ,son amigas, son talentosas etc

Publicado por krishna yohannet at 24/12/09 10:46:54

hannah montana la mejor ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡
selena gomez fea,tonta,gorda,gue...,cu...,mentirosa,pesada,orrible¡¡¡¡,selosa en exeso.
demi lovato creida,aburrida,linda.

Publicado por anais at 25/12/09 10:34:07

besos a todasss os quiero i love
de marta torres latorre tengo 9 añossss

Publicado por marta torres at 27/12/09 07:22:47

hola selena sos la mejor te
digo veo todo los dias
los hechiseros de
weberli place de verdad eres la mejor te quiero
muchisimo diria que soy tu fan numero uno pero
nadie me creeria te amo

Publicado por valentina at 27/12/09 18:38:45

Yo voto por Selena xq es THE BEST. I love you.
les escribo de Bs.As.

Micaela Aguirre, 9 años.

Publicado por Mika at 27/12/09 20:05:18


Publicado por damian at 28/12/09 20:35:03

HOLA YO VOTE POR MILEY Y SELENA QUIERO QUE GANEN LAS 2 OJALA yo las amo adoro nose porque son las mejores besos

Publicado por ABIGAIL at 28/12/09 20:39:23

sele sos mi idola total maile sos muy linda y demi regalame esa sonrisas sos divina:)

Publicado por rochi at 28/12/09 21:25:30

sele sos mi idola total te sigo desde q te vi., maili (hanna montana)sos re linda sos ermosa el papel de hannnah lo hases rree bbiieenn el 2 temporada ta guenisima y demi q puedo decir de vos esa sonrrisa q mata a todos sos una reina ustedes tres son mis idolas soy su fan numero 1 .tengo,11 años lllllaaaaasssss ammmoooo

Publicado por rocio at 28/12/09 21:34:32

sele sos mi idola total te sigo desde q te vi., maili (hanna montana)sos re linda sos ermosa el papel de hannnah lo hases rree bbiieenn el 2 temporada ta guenisima y demi q puedo decir de vos esa sonrrisa q mata a todos sos una reina ustedes tres son mis idolas soy su fan numero 1 .tengo,11 años lllllaaaaasssss ammmoooo

Publicado por rocio at 28/12/09 21:40:01


Publicado por SOFY at 29/12/09 19:11:40

las tres son divinas cantan y bailan y las tres son famosas y son muy populares y fantas ticas con amor y JeNsY

Publicado por JENSY at 31/12/09 12:05:09

llo soy gran admiradora de demilovato es la mas linda despues selena gomez y miley cyrus no me cae tamien la que adoro como canta actua y que esla mas bonita es DEMI LOVATO te super admiro eres la mejorrrrr.

Publicado por Aime at 31/12/09 14:42:29

demi: sos lo + te adoro soy muy fans tuya , selena : me encanta tu voz sos hermosa , miley : te odio no me gusta tu forma de ser lo unico bueno qe tenes es tu voz PP

Publicado por lucecitah at 02/01/10 14:20:09

bueno la verdades q demi lovato es la mejor de todas es muy bonita me gusta todo de ella despues selena esperemos q se qede con nik i miley no es tan

Publicado por paola at 02/01/10 15:06:45

bueno la verdades q demi lovato es la mejor de todas es muy bonita me gusta todo de ella despues selena esperemos q se qede con nik i miley no es tan

Publicado por paola at 02/01/10 15:11:22

ola a todos soy cielito y me gustaa mas selena gomezzz

Publicado por cielito at 02/01/10 15:56:03

toditas me encanta lo que acen pero me parece mejor miley

Publicado por yuletzy at 02/01/10 16:11:14

selena,miley y deimi lovato son lo mejor

Publicado por andrea at 03/01/10 13:25:13


Publicado por MARGARITA at 03/01/10 13:46:07

La mejor es Selena gomez!!! soy una fan de ella... y Demi es GENIAL... dos amigas inseparables! Pero Miley, SE HA BURLADO DE ELLAS DOS!!! lo he visto en un video... por favor!!! si esa chica es una tarada!!! por Dios!!

Publicado por Di di la + kpa! at 03/01/10 14:40:12

La mejor es Selena gomez!!! soy una fan de ella... y Demi es GENIAL... dos amigas inseparables! Pero Miley, SE HA BURLADO DE ELLAS DOS!!! lo he visto en un video... por favor!!! si esa chica es una tarada!!! por Dios!!

Publicado por Di di la + kpa! at 03/01/10 15:24:32

selena es una ermosa cantante y nadie la puede comparar en cambio hannah tiene voz de chancho y que se puede decier de demi tiene una voz poderosa selena y demi son causas del alma
1ºselena gomez
2ºdemi lovato

Publicado por fiorella at 04/01/10 23:09:30

para mi la mejor cita es demi por q selena gomez no demostro q es linda en esa imagen salio muy fea y miley cyrus tambien entonses la mejor es demi lovato

Publicado por roxana gomez at 05/01/10 08:42:13

Demi lovato es la mejor porque se mueve mucho en el escenario y canta genial y
yo me parecco mucho a ella.
soy Estela.tambien me encanta Selena
Gomez... es muy guapa, pero MILEY es
una tarada, pero muy guapa.

Publicado por Estela at 05/01/10 10:31:06

miley tu siempre has sido la mejor selena y demi no se igualan mucho a ti nadie es mejor cantante y artista q tu ni madona tu y hannah son lo maximo nadie se compara con ustedes.

Publicado por paola at 05/01/10 12:08:38


Publicado por MILEY I LOVE at 05/01/10 15:49:01


Publicado por XIMENA at 06/01/10 10:46:51

las tres chikas son muy geniales pero creo ke la mejor de ay es selena gomez...<3<3<3

Publicado por niki at 06/01/10 12:29:22

hola soy barbara solis quiero decirle que adoro a selena gomes, demi lovato y miley cyrus son mis preferidas las amo a parte mi sobrina s fanatica de todas tiene accesorios de todas chao un beso

Publicado por barbara solis at 06/01/10 20:27:27

hola demi y selena utedes son mejores que miley porque porque ella se burlo de ustedes por eso las quiero besos ausstdes dos pero no a miley

Publicado por valerie cabria at 07/01/10 15:04:18


Publicado por CATALINA at 07/01/10 18:48:08

selenaaaaa eres lo mejor si seños yo se cantar pero no tengo oportunida ayudame

Publicado por arianny at 08/01/10 10:00:27

selenaaaaa eres lo mejor yo se cantar me gusta mucho camtar pero no tengo oportunidad ayudame e escrito 10 canciones arianny hernandez

Publicado por arianny at 08/01/10 10:07:08

wola soy una gran segidora de demi lovato es mi idolo me gustaria conoserla y tener la opor tu noi dad de platicar con ella la amo es una gran cantante bye bye

Publicado por dany at 08/01/10 12:22:41

sele: me gusta tu cancion naturally mi prima amihga le gusta

miley me gusta tus canciones siempre en youtube lo veo tus videoclips


Publicado por VANE!!!!!!!!!!!!!;) at 08/01/10 14:24:58

demi es la mejor y yo yevo lo9 ke siento y demii es la mejor digan lo ke digan demii era,es, y siem´pre sera la mejor entendidop yo cantoo muiii byen pro me da pena cantar

Publicado por lissette at 08/01/10 16:29:21

selena gomezz

la re pero re pero re pero re major obvio a quien no le gusta selena gomez fan numero 1


Publicado por DANA at 08/01/10 17:23:26

me encanta selena es mi actris y mi cantante faboritooooon te quiero selena soy de venezuela !!!!! <3

Publicado por maria at 09/01/10 14:36:53

hola la mejor es selena gomez es re linda i nda gana contra todas

Publicado por gabriela at 09/01/10 16:46:24

selena ss la mejor actuas re bn i todo ss re linda te pomgas lo ke te pongas ss linda te kiero una banda , soi de argentina i veo tu programa :)

Publicado por gabriela at 09/01/10 16:53:18

hola yo soi fanatica de hanna montana es lo mas tkm te amo sos mi idola y me encanta ver tu programa es fabuloso besos

Publicado por florencia at 10/01/10 00:02:22

y selena es la mejor es obvio es re linda desde chiquita y ahora tambien canta re bien.Demi ni se compara,Demi es la ultima q yo elegiria.Miley es re linda y canta re copado,no se quien es mas linda y mejor,aunque miley se sarpa con sus fotos y selena sigue siendo una estrella ejemplo acique creo q elijo a Selena

Publicado por julieta at 10/01/10 10:35:58


Publicado por Daniela at 10/01/10 16:22:25

demi tu eres re linda y me llamo williannys y de miley y selena y tu te elijiria a tieres la mejor demi te quiero

Publicado por williannys at 10/01/10 17:49:15

selena gomez es lo mas!!!!! nadie es como ella y nadie le va a ganar ella es unica y .(punto) ok bueno mi nombre es abigail les deceo lo mas y listo chau selena gomez lo mas!!!!!

Publicado por abigail at 11/01/10 12:34:49

hannah ereslamejor eso sesave

Publicado por ashley at 11/01/10 16:58:50

hola me llamo camila y soy de buenos aires(argentina)querian que sepan que selena y miley cyrus son lo + nadie les va a ganar!!!!!:) bsssss

Publicado por camila at 11/01/10 19:48:39

hola me llamo camila y soy de buenos aires(argentina)querian que sepan que selena y miley cyrus son lo + nadie les va a ganar!!!!!:) bsssss

Publicado por camila at 11/01/10 19:53:06

ola moe llamo camila y soy de argentina queria q sepan q selena es mi idola,miley cyrus re linda con esos ojos rre lindos y demi lovato que decir de ella con esa sonrisa que te incnotisa son las 3 rebuena honda bueno bsssss!!!!!:)

Publicado por camila at 11/01/10 19:59:39

Son las mejores estrellas de Disney, ninguna supera a la otra. Yo creo que Miley, Demi y Selena ambas, las tres, son las reinas de Disney

Publicado por Sofi at 13/01/10 09:56:15

apoyo mucho a SELENA,DEMMI,MAILY.

Publicado por MAYERLIN at 13/01/10 15:08:47

hello miley selena and demi i´m love i´m angeles

Publicado por angeles at 13/01/10 15:24:57

hola para mi la 3 son las mejor les voy a sescir lo que me justa de cada una Miley:sos re pero re linda tu vos es explendida y todos los papeles te quedan.
Selena:tus hojos me encantan al igual que tu pelo es divino y me se todas tus canciones re re amo .
DEmi: miro todas las series de sunny .

y lo que me justa de todas es que las 3 son re buenas y buena honda las re a amo y espero que alguna vez estemos saludandonos frennte a frenta a las 3 la amo bs yo la gime.

Publicado por !!la gime!!!! at 14/01/10 09:54:53

perdon yo soy selena gomes y hablo enserio haora estoy aprendiendo a hablar en español saludos para todos mis fan y siempre estan en mi corason y mando saludos a valentina leiras que es mi amiga en el chat es muy tierna

Publicado por selena at 14/01/10 14:24:54

lamejor de mi gusto son selena gomez y demi lovato

Publicado por dayan at 14/01/10 16:21:24

hola a todos les queria decir qu esta ma que claro que selena gomez es la mjor maili es un asco y demi esta pasable pero selena ni que hablar selena es la mejor de todas las tres mejor dicho selena es mi idolla la amo siempre veo los hechiceros de waverly place les juro no me pierdo ni un capitulo y programa de proteccion para princesas tambien lo veo siempre sele sos mi idola mumero 1 te adoro te amoa me fasinaria conocerte te amo sele te amo te amo
m llamo karen mariel romero
te amo selena gomez te juro que no alcanzarian las computadoras ni los teclados ni la tita de lapiceras ni papel ni nada para expresarte cuanto te amo sele sos mi idola me fasinaraia conocerte

Publicado por karen at 14/01/10 18:13:10

selena gomes soy fanatica de tus cansion etc..

Publicado por javiera matilde at 14/01/10 20:49:55

selena gomes soy fanatica de tus cansion etc..

Publicado por javiera matilde at 14/01/10 20:49:57

selena gomes soy fanatica de tus cansion etc..

Publicado por javiera matilde at 14/01/10 20:50:14



Publicado por SELENA at 15/01/10 07:33:07

me encantan las 3 gusto mucho el papel que hicistes encantas eresla mejor haces reir del programa sunny entre estrellas fan tuya me gustas mucho ers la mejor.

Publicado por julud at 15/01/10 11:25:28

la mejor es selena gomez

Publicado por solcireth at 15/01/10 13:15:52

yo vote por hanna...porque me gustan mucho sus canciones...ademas es muy linda pero demi lovato tambien es linda y sus cancione son tan hermosas...en cambio selena gomes no es tan linda,y no me gusta mucho porque se metio con el pololo de miley cyrus.
Bueno ese era todo mi comentario y sobre todo me gusta mas hanna montana y miley cyrus

Publicado por catherine at 15/01/10 15:39:28

yo vote por selena gomez es la mejor

Publicado por barbara at 16/01/10 07:03:51

ovio yo vote por selena gomez se la mejor chica la quiero un monton
yo agus

Publicado por agus at 16/01/10 08:24:51

hola son geniales las tres

Publicado por emely at 16/01/10 20:21:05

para mi Demi es la mejor la kiero desde el principio k la vi en camp rock canta bien,es linda,tiene canciones hermosas,en pocas palebras es lo mas. selena me empezo a gustar ahora pero tambien es la mejor.creo k ahi falta taylor swift...bueno las reinas 1.DEMI 2.SELENA

Publicado por SaMy at 17/01/10 15:25:11

selena gomes es la mas bonitaaa me encanta

Publicado por florencia at 17/01/10 22:17:58

me encantan todas menos miley cyrus
pero para mi la mejor es
--selena =)
es unica es una Diosa me encanta
creo q sus padres estan orgullosos de ella
bueno eso es lo q pienso de
demi es muiy linda
pero no tanto igual me gustan sus canciones y su forma de ser
me encanta q actue junto a selena
son muy amigas :)
las quiero mucho a las 2°
pero odio a miley cyrus
es una idiota me parese q no deve ser para Disney por su facilidad para mostrar su cuerpo
las mejores seran
siempre le ganaran a la indesente de
miley cyrus.
Chau muy linda su pagina
aahh y antes q me olvide selena y demi
salen HeRmOsAs en esa FoTo

Publicado por fans-de-selena-y-demi-- at 17/01/10 22:32:40

hola,prima selna como estas?ya nos veremos por ahi

Publicado por anonimo at 18/01/10 09:34:38

Demi Lovato es la mejor!!! sus canciones son hermosas(igual k ella)es 1 exelente actriz y kiero muxo...Selena Gomez tmb!!! actua re bien y canta bien...tmb la kiero...pero miley no supo mantenerse hasta le dieron el premio a peor influencia!!! igual k samy kreo k falta Taylor Swift... DEMI primero,SELENA segundo y TAYLOR tercera

Publicado por samantha at 18/01/10 11:50:55

hola maili sos mi idola hola celena en los hichiceros sos lomas
y te estoy miranfdo por tv en la cerie de los hechiceros y demi sos re bonita me dio risa en protecion de princesas que una princesa aya ebrutado

Publicado por luna at 18/01/10 13:01:05

selena gomez tueres lamejor mellamo daniela pero yoeescrivi el correo demiermana soy tu fans #1 vivi en colombia yo qui siera verte abrasar y de sirte quello tequiero como una ermana ojala quetuviniera amicasa vivi en el barrio 7 de agosto m 7 c 6
ha nomeolvides mandale saldos ade milovatoyo bote porti

Publicado por danuela at 18/01/10 20:27:46


Publicado por BARBARA at 19/01/10 10:21:12


Publicado por BARBARA at 19/01/10 10:24:05

yo tengo un paresido a selena perro en los echiseros soy super chida abeses como alex osea selena soy super osea genial creo que soy la mejor XD

Publicado por mel at 19/01/10 16:15:21


Publicado por sandra at 20/01/10 13:24:13

ami me da = chikos ami me gustan las tres... pero de ellas me gusta 1º miley cyrus 2º selena gomez y 3º demi lovato... bbyyyeeeee.....

Publicado por anonimo at 21/01/10 12:55:42

selena sos super me llamo serena gomez es casi el mismo nombre vio mi amiga en una pagina de disney que salias en ropa interior eso es muy feo para nosostros los niños

Publicado por serena at 21/01/10 16:06:32

oye es selena gomez la preciosa ok miley es feaaaa y demi es bonita las mejores son selena y demi ok miley entiendes o telo dibujo tonta miley.

Publicado por massiel at 21/01/10 17:24:11

holaaaaa demi eres la mejor hasta te imito chekealo soy karina

Publicado por karina at 21/01/10 21:44:51

ola selena como estas espero que bien solo queria decirte que te admiro mucho y que tu me inspiras para poder seguir adelante espero poder conocerte algun dia eres una maravillosa persona te deseo mucho exito en tu carrera artistica te dejo mi coreo por si decides escribirme es te quiero mucho bye

Publicado por manuel antonio ventura at 21/01/10 23:58:18

selena.demi.maili:les queria desir que las tres son re buenas y lindas tienen buena onda y son muy graciosas las re quiero mucho y les deseo buena suerte a las tres besos

Publicado por belen at 22/01/10 13:34:01

holas selena miley y demi me llamo nicoll soy de peru, lima y quiero q sepan q me inspiran para seguir adelante y espero conoserlas muy pronto bueno me voy les doy mi correo es escribeme me voy las quieromucho parfa escribanme las 3 adios

Publicado por nicoll at 22/01/10 14:36:28

selena eres la mejor para mi pues pienso q eres la unica q no anda metida en los alvorotos de el mundo como miley anunq eella tambien me gusta

Publicado por sherydan ballesteros at 23/01/10 14:20:00

hola hannna montana yo se que eles talentoso pero aveses te pasas de la ralla tanvien deves de saber lo que ases ay avess que lo diegas pero te pasas de vevir con tu novio espero que no se acabe la temparada de hanna montana esta chi9da bueno bye

Publicado por deniss at 23/01/10 23:08:14

hola miley eres la mejor soy de arcos de la frotera. me se todas tus encantan. eres la mas guapa y la que canta mejor.

Publicado por lucia at 24/01/10 08:29:24

hola miley eres la mejor soy de arcos de la frotera. me se todas tus encantan. eres la mas guapa y la que canta mejor.

Publicado por lucia at 24/01/10 08:31:21

soy una gran admiradora de selena y hanna pero me molesta y me desepciona que hanna deje su carrera pero si es para atraer publico no es chistoso

Publicado por gaby at 24/01/10 09:17:04

soy mikaela quiroga espero que esto les llege a todos HANNAH SELENA Y DEMI SON GENIALES me encantan lass canciones te climb naturally y las de demi

Publicado por mikaela quiroga fernanadez at 24/01/10 14:19:43


Miley Cyrus es una SARPADA!!!!! acaso no saben como es ella... tienen q saber mas sobre miley cyrus, no me gusta como canta pero me gusta como >ACTUA

Selena Gomez: Es una marivillosa cantante y actriz y ella mantiene su fama... no hace nada malo ni anda provocando escandalos

Demi Lovato: canta Genial! bueno, selena y ella son mejores amigas... pero creo q demi tiene un muy buen humor y todo pero ella tambien es algoo... bueno ya saben...


Publicado por M€{@N¡€ at 25/01/10 12:04:45

la M con mayuscula

Publicado por melanie at 25/01/10 12:13:47

me encanta estan guapisimas la mejor selena y demi .

Publicado por laura quintana garcia at 25/01/10 14:52:37

me encanta estan guapisimas la mejor selena y demi .

Publicado por laura quintana garcia at 25/01/10 14:56:50

hola me llamo vale y me encanta demi lovato soy fan N#1 de demi lovato xao!!!

Publicado por valentina at 25/01/10 15:01:36

ola me llamo josshelyn soyy peruana me gusta como trabajas eres super me gustan tus canciones eres la mejor como quisiera q visites el peru es super lindo animate te esperamos te dejo mi correo

Publicado por josshelyn at 27/01/10 12:08:11

hola soy astrid de peru las 3 son buenas .pero yo prefiero a selena gomez me encanta es mi idolo , es la mejor en todo lo que hace , demi y hanna aunque tienen mayor trayectoria no le ganan a selema me encantas ,te quiero mucho

Publicado por astrid at 27/01/10 13:29:36

Ami me encanta Selena Gomez



Publicado por Belen at 27/01/10 20:50:26

creo que las tres son realmente fantasticas pero tengo q escojer ah una selena gomes pienso q es la mejor de todas sigan asiendolo asi q van muy bien.....?????

Publicado por hilarie at 28/01/10 11:25:04

creo que las tres son realmente fantasticas pero tengo q escojer ah una selena gomes pienso q es la mejor de todas sigan asiendolo asi q van muy bien.....?????

Publicado por hilarie at 28/01/10 11:30:23


Publicado por CAMI at 28/01/10 16:08:52

hola soy camila me encanta selena gomez es my cantante favorita besos chau!

Publicado por camila at 28/01/10 22:20:37

me encantasssss hannah miley soy tu mayor fans cantras bien eres wapisima me encantas . demi lovato me en cantaa tu musica y tu serie eres la mejor.selena gomez me encanta tu musica los magos de waverly place en fin eres la mejor me encantais las tresssss

Publicado por wendy at 29/01/10 11:53:22

me gusta mxo miley cyrus y selena gomez
las dos son xvrs y las apoyo 100pre

Publicado por ray at 29/01/10 17:48:34

miley selena y demi son las mejores ojala las pudiera ver en persona nunca se han presentado en ciudad victoria y plissss ya no se peleen por q las tree son lo maximo del mundo junto con los jhonas y ya no se peleen las queremos a las tres por igual mis amigas beraly frida cinthia olga y en especial my

Publicado por yaneth at 29/01/10 23:19:11

las 3 son muy buenas!! selena me gusta mas q todas,pero las 3 tienen talentos fuera de serie!"

Publicado por lore at 30/01/10 21:11:58


Publicado por SEDEMI at 31/01/10 12:10:05

selena gomez y miley cirus son las mejores y las mas buenas

Publicado por itzayana at 31/01/10 16:29:43

demi es la mas vonita
selena fea
hana montana ooooorrible

Publicado por jocelin at 31/01/10 17:37:44

ami me encanta selena gomez y demi lovato son las 2 maejores actrises de todo el planeta tierra mi msn es por si demi op selena ven mi msndj es lacamu_2003@hotmail

Publicado por camila at 31/01/10 23:49:05

Demi lovato es LA MEJOR¢¾

Publicado por Floor at 01/02/10 11:27:13

Hannah montana es la mejor. eso pienso yo. para mi la lista seria asi: la primera Hannah Montana, despues Demi lovato y por ultimo Selena Gomez. perdon si se enoja selena gomes o de mi lovato pero eso pienso yo. Igual me gusta selena gomez y demi lovato. yo soy fanatica de las tres. las super quiero mucho. soy una mas de sus fanz. quisiera conocerlas pero no puedo.

Publicado por Cintia Yakes at 01/02/10 12:58:19

Hannah montana es la mejor. eso pienso yo. para mi la lista seria asi: la primera Hannah Montana, despues Demi lovato y por ultimo Selena Gomez. perdon si se enoja selena gomes o demi lovato pero eso pienso yo. Igual me gusta selena gomez y demi lovato. yo soy fanatica de las tres. las super quiero mucho. soy una mas de sus fanz. quisiera conocerlas pero no puedo.

Publicado por Cintia Yakes at 01/02/10 13:05:43

hola me llamo valeria tengo 6 años soy fans tuya me gusta solo a hannah montana por que eres hermosa tienes talento soy de bucaramanga colombia te amo cantas hermoso y me veo hannah montana mas demi y selena son peores no me gustan eres una super estrella eres pop rock estar llacson tu papa si te cansan mucho quiero verte ven a bucaramanga porfis las quiero mucho las amo las adoro estrella siempre voy aser fan numero 1 la amo la quiero mucho chauuuuu

Publicado por MILEN VALERIA HERRERA at 01/02/10 19:32:04

hola me llamo valeria tengo 6 años soy fans tuya me gusta solo a hannah montana por que eres hermosa tienes talento soy de bucaramanga colombia te amo cantas hermoso y me veo hannah montana mas demi y selena son peores no me gustan eres una super estrella eres pop rock estar llacson tu papa si te cansan mucho quiero verte ven a bucaramanga porfis las quiero mucho las amo las adoro estrella siempre voy aser fan numero 1 la amo la quiero mucho chauuuuu

Publicado por MILEN VALERIA HERRERA at 01/02/10 19:35:48

A mi me encantas hanna montana porque eres muy linda cantas y actuas genial deberias venir a colombia aqui te esperamos

Publicado por MILEN VALERIA HERRERA at 01/02/10 19:41:48

A mi me encantas hanna montana porque eres muy linda cantas y actuas genial deberias venir a colombia aqui te esperamos

Publicado por MILEN VALERIA HERRERA at 01/02/10 19:42:16

aver selena gomez es relindha es hermoxa miley sirus es lindha i demi lovato es medio lindha la eso kiere desir k selena gomez es la mas hermoxa t.k.m selena gomez xD

Publicado por claudia at 02/02/10 08:05:25

demi y selena son las + bonitas

Publicado por erca at 02/02/10 16:16:38

ami me ancanta demi lovatoo tiene una voz genial k nadie la podria tener la de hannah es mas suave y demi saka la voz stoy un poko molesta con selena gomez porque sta knj la tontaa de taylor swift ii dejo sola demi lovato kl mala sos sele....!!! las kiero demi y hannah son las mejores jaja sele un poko no mas vamos demi...

Publicado por alee.... at 02/02/10 19:18:10

Para mii la mas bOniittah! eSZ Demii LOvatOh! y m apesta prefiero ver porno

Publicado por Meliisa at 02/02/10 21:05:38

demi lovato la mejor del momento por que es super guapa y canta supera bien arriba demi abajo miley

Publicado por las demis at 03/02/10 02:51:50

les adoro a las tres mas a niley le conosco

Publicado por sofia at 03/02/10 13:57:15

ami me gusta selena demi y miley pero no se que decidirme!!! pero yo voto por las 3 y los jonas!

Publicado por ariadna at 03/02/10 16:39:19

hola selena eres la mejor

Publicado por valeria at 04/02/10 12:37:27

hola bueno tengo que escoger una mejor seria describiendolas. selena gomez: canta muy bien, tiene arta personalidad, sabe expresarse y tiene la voz GENIAL canta muy bien. demi lovato: al igual que selena tiene muy linda voz, hicieron un videoclip one the same, es muy lindo el video. miley cyrus: tiene una serie que se llama hannah montana tiene mucho exito, ella es la cantante mas grande de pop por el momento. Bueno debo decir que la mejor es Selena (sin animo de ofender) Las tres son muy buenas en el canto y ese tipo de cosas pero creo que la que tiene mayor nivel de personalidad y canta mejor es Selena y con Demi tambien cantan las dos muy bien ese video esta muy lindo ellas dos la cantaron le quedo perfecto. Bueno ojala le guste mi opinión bueno adios.

Publicado por mikaela at 05/02/10 18:20:18

la mas bella es selena gomez sin ofender ustedes tambiem son bonitas pero no le ganan a selena gomez las quiere besos abrasos bye bye besos selena , demy , y mailei besos

Publicado por gabriela at 05/02/10 20:02:28

hola selena sos la mejor y tambien demi lovato y Miley Cyrus sosn lo mejor del pop las quierio muchooooo las quieroo soy su fan numero 1

Publicado por roci at 05/02/10 22:16:44

hola selena eres la mejor hannah apesta la odioooooy a demi no entiendo porke te separas de ella
att: josi tu fan numero 1 hasta en la foto de mi hi5 estas.....

Publicado por Josi at 06/02/10 11:53:59

ay yo digo que es selena gomes
es a megor por sus
peliculas estan de lugo
y tengo una prima y yo que la
abm8iramos a selena gomes
selena es la megor

Publicado por ana karen at 06/02/10 11:56:47

el verdadero nombre de hanna es vova
tonta y pesada

Publicado por rosario at 06/02/10 12:17:04

Demi lovato es la mejor es la mas bonita y es es mas que una buena cantante canta de maravilla selena y miley tambie son bonitas y buenas cantantes las tres son lo maximo pero tiene que aber una mejor y es demi lovato.

Publicado por Aime at 06/02/10 12:34:51

selena cantas bien hana eres muy linda
demi me gusta tu personaje de sonny

Publicado por shania at 06/02/10 22:08:09

jajajjaj miley cyruz k mostra es jajajajj no mentira es igual k demi lovato

Publicado por !!!¡¡¡¡¡¡ luciana11!!!!¡¡¡¡¡ at 07/02/10 16:21:46

hola demi lovato
y selena
ustedes son lo maximo son nuestras idolas somos dallana y valeria
les mandamos esto a usteedes por k son lo maximo en cambio maili osea
hanna montana nos cai gorda por eso le desimos hanna fuma la montana bueno somos sus fans numero 1 bueno bay

nosotras somos como ustedes la mejores amigas

Publicado por valeria mariel at 07/02/10 19:31:32


Publicado por DAIANA at 07/02/10 19:52:20

hola chicas, miley cyrus sos re copada y selena no se queda atras son geniales un dia de estos me voy a ir a verlas a ustedes ya conosco sus direcciones las re quiero so n favulosas ah sele me encanta tu cancion magic

Publicado por maria laura at 08/02/10 10:03:26

selena gomes es popular muy divina top lo que uno puede decir de una verdadera estrella del rok es una excelente actriz es bonita bakan pero igual me gusta mucho demasiado demi lovato al igual que hannah montana me encanta la cancion de demi this is me y las de hannnah montana todas son buenas actoras . y la lili de hannah montana increible yo soy una excelente bailarina y cantante me encanta cantar tengo artas amigas

Publicado por yane at 08/02/10 20:56:49

hannah selena y demi son las mejores
siempre veo los capitulos de hannah montana, los hechiceros de warvwely place y sunny entreestrellas son geniales a ti te gusta?????
pues veelo en disney channel es suuuuuper.

Publicado por yasmin at 09/02/10 15:34:43

hannah selena y demi son las mejores
siempre veo los capitulos de hannah montana, los hechiceros de warvwely place y sunny entreestrellas son geniales a ti te gusta?????
pues veelo en disney channel es suuuuuper.

Publicado por yasmin at 09/02/10 15:35:41

wola esta muy bonito

Publicado por alejandra at 09/02/10 16:48:22


Publicado por IVANIA at 09/02/10 18:49:32

selena sos mi cantante faborita mi sueño es q seas mi hermana pero q bamos a hacer

Publicado por agostina at 09/02/10 19:59:22

holaaaaa soyjulieta de argentina y soy fan de demi lovato!!!!! no se porque para votar en cual es tu preferida va tercera si ella para mi tendria que ir 1 obio es la mejor y esa miley cirus no me gusta mucho pero es talentosa y selena tambien pero para mi la mejor de disney es demi
demi te queria decir que sos la mejor y espero poder conocerte algun dia para mis quince me quiero ir a disney capaz nadie sabe que vos justo vas y nos encontramos espero que pase eso

Publicado por julieta fan de demi at 11/02/10 08:33:43

selena yo vote por ti porque yo soy tan popular como vos poreso esres identica a mi eres sinpatica si tubu tu msn seria una locurami cancin avrita es magic/miley mi cancion favorita es party in the u.s.a. esa cancion es na locura la tego en i ipòt te atmiro enserio tengo una amiga que simula ser tu que pena porque esa amiga que tengo esta loca le lisen la changa jajajaja puedes creerlo/demi tu eres la megor amiga de selena y adivina que yo me creo selena y mi megor amiga tu ella te atmira si ella tubiera tu correo moriria es enserio le enseñe un poster tu yo y casi se desmaya imaginate si tubiera tu correo ni pensarlo

Publicado por ana cecilia at 11/02/10 16:05:46

selena gomez es lo mejor en mi vida ok soy daniela la . com <3 <3 <3 <3 <3 <3 <3 <3 <3 <3 <3

Publicado por daniela at 11/02/10 20:50:31

hola yo voto por selena gomez es muy bonita canta muy bien y sus juegos son mas divertidos en segundo lugar esta miley soy su fan numero unooooo y en tercer lugar demi lovato es muy bonita etc adios chicas besos a las tres

Publicado por alejandra at 11/02/10 22:14:28

hola mileyyy soy tu fan #1 me encanta tus canciones y todo tambien las canciones de demi y selena pero tu eres mejor q ellas mucho ,mejor y mas linda q selena te adoroooo byee miley son tu fan no te olvides jajaja es verdad soy tu fan

Publicado por maira at 11/02/10 23:10:25

holaaa selena me encantas aunque no se como asen la maguia yo siempre intento aser con algo pero no me sale bueno segimos con el tema selena gomes me encantas muho y te adoro como desearia que yo tubiera al lado tuyo fuaa me das tanta emosion yo nunca me e perdido tus programas a y me encanta tu ermanito ay es rre lindo ogala sea mi novio tuhermanito max bueno espero que estes muy bien y bueno me tengo que ir adios adios hanah adios selena adios demi los adoro a las tres hauu

Publicado por candela at 12/02/10 01:25:41

te adoro selena gomes igual que demi lovato no tanto a miley cyrus. besos para todas

Publicado por yamila at 12/02/10 07:01:22


Publicado por ZAYRA at 12/02/10 08:48:53

oviamente debe ganar selena despues miley y despues demi!!! yolas pindria en ese orden,, no se usted??pero lo q se esd q SELENA E SLA MEJOPR Y TAMB ES LO MEJOR Q KLE PASO A DISNEY CHANNEL!

Publicado por sofy at 12/02/10 09:32:30

hola selena yo soy tu mayor fan y me encanto la musica que isiste naturally

y hannah me encanta la musica super girl

demi me enanta tus musicas !!
saludos las quiero ^^ =) :)

Publicado por brenda at 12/02/10 14:53:14


Publicado por ana cecilia montoya contreras at 12/02/10 16:00:41

hola me llamo mayra y miley es mi idola con selena gomez soy su fan numero 1 las adoro a las dos ojala
pudiera hablar con mo ellas en ingles
me en cantaria muchicimo las qiero

Publicado por maira at 12/02/10 20:07:38

weno las mas lindas son demi lovato y selena gomes eiiaz!!¢®¢®¢¾¢¾ nomas por k miley cyruz no pasa mas pasan selena gomes y demi lovato

Publicado por christian at 13/02/10 16:14:20

selena eras mi cantate faborita y mansima trabajas muy bien en los hechiseros de weril peles

Publicado por macarena at 13/02/10 21:55:56

selena eras muy linda y eras la cantete mas famosa si enpre te veo en dysnel chanel y bas estar con za y cody besooooo

Publicado por macarena at 13/02/10 21:59:22

esa demi es la mejor es mi prefe y la kiero muxo para mi eres lo +++++...

Publicado por alba at 14/02/10 09:02:39

hola chicas quiero desirles que soy su fan numero 1 hanna te amo nunca me pierdo un programa tuyo sos la mejor segui asi y ojala algun dia pudiera conserte demi te amo con todo mi corazon y quiero que sepas que quiero ser vos me ise el peynado igual que bos para pareserme a bos so tufan numero 1 nunca dejo de mirar tus programas te amo selena me encantastes desde el 1 dia que te conosi por tele soy tu fan numero 1 segui asi y ojala pudiese conoserte chicas lasssss amooooo muchooooo ayelen bonelli su fan numero 1 las amo y mi primer deso que boy a pedir el 8 de marz mi cumpleaños es conoserla por que las amo igual que los jonas les mando un beso muy grande ayelen bonelli

Publicado por ayelen bonelli at 15/02/10 08:56:29

hola chicas quiero desirles que soy su fan numero 1 hanna te amo nunca me pierdo un programa tuyo sos la mejor segui asi y ojala algun dia pudiera conserte demi te amo con todo mi corazon y quiero que sepas que quiero ser vos me ise el peynado igual que bos para pareserme a bos so tufan numero 1 nunca dejo de mirar tus programas te amo selena me encantastes desde el 1 dia que te conosi por tele soy tu fan numero 1 segui asi y ojala pudiese conoserte chicas lasssss amooooo muchooooo ayelen bonelli su fan numero 1 las amo y mi primer deso que boy a pedir el 8 de marz mi cumpleaños es conoserla por que las amo igual que los jonas les mando un beso muy grande ayelen bonelli

Publicado por ayelen bonelli at 15/02/10 09:20:12

hola chicas quiero desirles que soy su fan numero 1 hanna te amo nunca me pierdo un programa tuyo sos la mejor segui asi y ojala algun dia pudiera conserte demi te amo con todo mi corazon y quiero que sepas que quiero ser vos me ise el peynado igual que bos para pareserme a bos so tufan numero 1 nunca dejo de mirar tus programas te amo selena me encantastes desde el 1 dia que te conosi por tele soy tu fan numero 1 segui asi y ojala pudiese conoserte chicas lasssss amooooo muchooooo ayelen bonelli su fan numero 1 las amo y mi primer deso que boy a pedir el 8 de marz mi cumpleaños es conoserla por que las amo igual que los jonas les mando un beso muy grande ayelen bonelli

Publicado por ayelen bonelli at 15/02/10 09:21:56

hi mi nombre en anapaula selena mayli tengo tres nombres y 2 sos de mis cantantes faboritas mayli y selena mi sueño verla porq vos y vos son estectaculares las quiero besos

Publicado por anapaula at 15/02/10 12:13:30


Publicado por lucrecia at 15/02/10 15:02:33

Hola a todas soy de 4 me gusta más pero no puedo elegir pero en la vida ahi que elegir pues elijo a Selena yo desde pequeña me a encantado tu voz y tu personalidad en Los magos de waberly place.Yo nunca me pierdo las pelis de demi y de ti por ejemplo programa de protecsion de princesas,la mas quee me gusto en la pali fuiste tu Seelena y también me encanto la peli de los magos de waberly place vacaciones en el carive

Publicado por Jenny 4 at 15/02/10 16:02:19

Hola a todas soy de 4 me gusta más pero no puedo elegir pero en la vida ahi que elegir pues elijo a Selena yo desde pequeña me a encantado tu voz y tu personalidad en Los magos de waberly place.Yo nunca me pierdo las pelis de demi y de ti por ejemplo programa de protecsion de princesas,la mas quee me gusto en la pali fuiste tu Seelena y también me encanto la peli de los magos de waberly place vacaciones en el carive

Publicado por Jenny 4 at 15/02/10 16:03:43

selena gomes es buena pero demi es todavia mejorrrrr pero a que yo si se quien le gana a ella la bella de mi hermanita hanna montana identidad secreta miley cyrus

Publicado por natasha at 16/02/10 11:21:45

hola demi soy tu mayor fans de gusta la seri sunny entre estrela

Publicado por bianca at 16/02/10 15:04:38

guaoo demi lovato es la mejorr le doy el primer lugar a selena gomez le doy tanbn el primer lugar uuuuu par maylyy eres la peorr vete al diabloo estupida le quitastes el novio a selena gomezzz bueno chitoo sien urassss para demi y selena 100% para ellas las amoo de su primera acmmiradoraaa yurian 1 nuemro uno ???? siii

Publicado por yurian at 18/02/10 12:13:05

guaoo demi lovato es la mejorr le doy el primer lugar a selena gomez le doy tanbn el primer lugar uuuuu par maylyy eres la peorr vete al diabloo estupida le quitastes el novio a selena gomezzz bueno chitoo sien urassss para demi y selena 100% para ellas las amoo de su primera acmmiradoraaa yurian 1 nuemro uno ???? siii

Publicado por yurian at 18/02/10 12:13:22

demi eres la mejor selena tambien eres la mejor te adorooo maylii bete al diabloo uuraaa para selena y demi100% para ellASS SIII

Publicado por YURIAN at 18/02/10 12:16:58

yo boto por selena gomes por que es linda y seria chebere que la pudiera cono cerla.

Publicado por lili at 18/02/10 16:05:00

te quiero super quiero quiero pedirte un consejo. mi mejor amiga tiene novio y es mi mejor amigo y a mi me gusta mi mejor amigo pero tengo novio y le gusto tanto que dise que me ama el aÑo pasado me imbito a bailar y no quise poque crei que nos ibamos a besar entoces digo que le abia aruinanado el dia del cariÑo

Publicado por isabela at 18/02/10 19:08:06

las amo a las tres pero mi voto es para selena gomes es la mas linda del universo y x eso esta con nick jonas

Publicado por rocio at 19/02/10 12:59:02

te quiero selena gomes y demi lovato

Publicado por melina at 19/02/10 14:18:51

hola selena y demi

Publicado por melina at 19/02/10 14:20:28

todas son hermosas pero la primera es miley despues sele y despues demi ..! y yo no me pierdo ninguna serie ni hannha montana ni los hechiseros ni sunny entre estrellas !!


desiaria tener un autografo de ustedes y tambien muchas fotos!! y me encantaria poder conoserlas!!


Publicado por Fma! ??? !! at 19/02/10 21:59:34

Hola miley Hola selena Hola demi soy su fans numero1 me encanta su es super padre adios las quiero muchooooo

Publicado por jahaira at 20/02/10 09:31:20

no pos yo voto ´por SELENA GOMEZ porqu ez la mejor y hanna y demi van a perder buuuuu

Publicado por *CcAaNnDdY* at 20/02/10 19:53:25

no pos yo voto ´por SELENA GOMEZ porqu ez la mejor y hanna y demi van a perder bu

Publicado por *CcAaNnDdY* at 20/02/10 19:54:10

wave as they are good I just wanted to say that they are all the bkn osea la demi selena and miley are bkn mas pa qe know and are friends over good bye.

Publicado por destiny hopen molina at 21/02/10 11:05:20

selena es un asco abeses es muy creida y demi ovato es la mejor del mundo su programa es un exito y hanah es un buen programa

Publicado por albina at 21/02/10 22:58:12


Publicado por FIORELLA LLAMBÍ at 22/02/10 12:23:08

hola yo voto por miley porque es la mejor cantante pop del momento

Publicado por macarena at 23/02/10 10:52:29

hola me llamo macarena y voto por miley porque me encanta y es la mejor cantante pop del momento

Publicado por macarena at 23/02/10 10:59:03

las mejor son las tres las quiro muchooooo las amo con cariños su a miga del alma¡¡¡
las miro todos los dias aguanten las tresssss

Publicado por iva at 23/02/10 12:40:20

sele te adoro soy tu fan numero 1 nunca me pierdo los hechizeros de waverly place me llamo valentina ren

Publicado por valentina ren at 23/02/10 14:02:05

selena gomes eres mi favorita y tambien demi lovato la miley noo

Publicado por jocelyn at 24/02/10 09:36:54

selena gomes eres mi favorita y tambien demi lovato la miley noo

Publicado por jocelyn at 24/02/10 09:37:23

selena sos la mejor mayli y demi tambien son lindas pero vos sos la mejor

Publicado por anonimo at 24/02/10 10:24:28

hola para selena y demi son las mejor y mayli es maso pe la q mas me gusta es ¡¡¡demi!!! despues "selena" y ulltima de todos es (mayli) y chicas yo voy a lansar mi disco a la tele y lo pueden ver adios y besos grandes a nick jonas y joe jonas los amo adiosotto yo:gatti

Publicado por agustina at 24/02/10 12:55:32

ola hannah soi tu mas gande admiradora y de selena pero sin kerer vote x demi pero no sabia de ke era eso pero ya vote x ty y x selena bueno bay se kuidan ok besos , y muchos saludosz

Publicado por perla at 25/02/10 00:40:43

SELENA es la mejor demi masomenos y miley la peor porke poso desnuda e hizo muchas cosas sucias.arriba SELENA , abajo miley y bien por demi.

Publicado por ro at 25/02/10 16:16:40

hola para mi la mas linda es selena despues las demas son todad feas chau

Publicado por coro at 25/02/10 17:11:59

yo apoyo a las tres pero qa quien mas apoyo es a selena tiene una vz increible y s una divi a la moda al igual q demi,miley adios

Publicado por angely at 26/02/10 11:46:58


Publicado por FIORELLA LLAMBÍ at 26/02/10 13:51:45

demi lovato soy su fan como selena gomez y hanna montana pero como m gusta el rock me gusta mas las cansiones de demi lovato y esta muy bonita y por eso digo k demi lovato es la mejor :)tqm demi lovato ¢¾¢¾¢¾¢¾ ¢¾¢¾¢¾¢¾¢¾¢¾ **** *****

Publicado por kenia at 26/02/10 14:58:48

hola selena eres la mejor

Publicado por irati at 27/02/10 12:35:47

miley! sos una kapa pro no te prefiero :/
demi!!! te re quiero y cn vs me mato de rissa pero tampoco sos mi favoritta :D
selena!! te recontra admiro y sos re buena cantante igual q tus compas :) miley y demi (L) las admiro muchoo a todass..... pero me quedo cn selenaa..... XD me gusta la cancion y el video de naturally !&#9829;&#9829;&#9829; :) byeee las quiero &#9829;&#9829;&#9829;

Publicado por V@ky (♥) at 27/02/10 16:42:47

todas no saven nada pero yo soy tu fan nº1 demi lovato como dicen tu sonrisa es ermosa selena gomez sos re linda y actuas, cantas re bien y hanna sos re linda y cantas re biem

Publicado por camila at 28/02/10 14:25:27

selena gomes!!te adoro mire todas tus peliculas nunca me pierdo los echiceros de wely place teadoro escribeme a mi correo por favor.maley cyrus!!te adoro me se todas tus canciones nunca me pierdo hanna montanaescribeme a mi correo por favor.demi lovato!!te adoromire todastus peliculas nunca me pierdo sonny entre estrellas y camp rock escribeme a mi correo por favor.las adoro diosas!!!!!no se olviden de mi!!chuau chicas no saben como las quiero sos diosas de verdanlas amo!! me ice una remera de las tres juntas para el colegio las adoro diosas!!!!!

Publicado por eliana at 28/02/10 15:39:18


Publicado por AILEN at 28/02/10 18:18:49

hola amo a miley cyrus y a selena espero que hannah venga a paraguay by guada

Publicado por rosa guadalupe at 28/02/10 19:39:29

hola miley cyrus selena soy su admiradora quisieran que vengan a paraguy

Publicado por rosa guadalupe at 28/02/10 19:44:51

les queria decir que ustedes son super coll la mejor para mi es selena mi correo es quiero que lo agreguen a su msn para asi poder conversar con ustedes gracias y si me agregan a su msn se lo voy a agrsdecer mucho en el alma hasta la proxima las quiero espero sus invitaciones para el msnchao...

Publicado por carolina nataly guzman castro at 01/03/10 20:07:45

les queria decir que ustedes son super coll la mejor para mi es selena mi correo es quiero que lo agreguen a su msn para asi poder conversar con ustedes gracias y si me agregan a su msn se lo voy a agrsdecer mucho en el alma hasta la proxima las quiero espero sus invitaciones para el msnchao...

Publicado por carolina nataly guzman castro at 01/03/10 20:14:19

todas son mejores pero la mejor si ofender es patito y mateo y aonella

Publicado por alicia nallely at 02/03/10 16:01:05

para su imformacion soy miley si quedan con la boca abierta no me importa yo soy la mejor no selena ni demi son mugres son peludaas soy hannah y agradesco a mis fans por votar por mi

Publicado por miley cyrus at 02/03/10 17:24:49

hola yo soy catalina y la estrella mas linada es hannah montana pòrque megustan sus cansione.

Publicado por catalina vega at 02/03/10 22:56:35

demi lovato y selena gomes son conchudas

Publicado por flor at 03/03/10 16:35:56

hola somos tamy y ceci y queremos que hannah montana venga a chile,y porfavor hannah danos dos entradas a tus fans favoritas gracias adios te queremos mucho .....

Publicado por admiradoras de mailey cyrus at 03/03/10 20:02:34

odio a demy y a selena son las dos unas tontas (AGUANTE MYLEY) ELLA SI ES UNA ACTRIS NO COMO LAS ESTUPIDAS Y TROLAS DE LAS OTRAS DOS ya no bale la pena nombrarlas son bien pelotudas jajajaja AGUANTEEEEE MYLEYYYY

Publicado por CANDE at 05/03/10 10:28:54

selena eres la mejor y bote x ti x q me caes de maravilla miley cyrus es una porqueria y demi tambien me cae bien pero miley cyrus me cae de lo peor nunca me cayo bien esa estupida miley cyrus ella y su progarma es una porqueriaestupida.....miley cyrus eres una perdedora y no mereces ser amiga de demi lovato y selena gomez no lo mereces estupida me caes mal te odio con todo

Publicado por stephany at 05/03/10 16:33:26

hola a todos soy de peru y yo creo q la mejor yla mas cool es selena gomez , pero la demi y la miley tambien son bonitas , soy las fans de todas

Publicado por arlin at 05/03/10 21:04:37

Q hermosas las fotos jejejjejjjjje

Publicado por celeste macias at 06/03/10 09:19:40

no se quien o quien sera la mejor osea yo ninguna de las tres son la mejores bueno nada ma s que demi lovato y miley son la s mejores no selena ella es orrible y mandona ya no quiero nada con ella osea jelou vay besoos aaaaa tttttooooodddddooooo a demi lovato y a miley y no mires mis mensajes selenota cara de ponpas

Publicado por carol at 06/03/10 09:24:55

selena gomez es la mejor en todo en hechiceros de gueran y ples el las canciones en actuar es mi idola me se todas sus canciones inclullendo la de magic.

Publicado por anna camila at 06/03/10 21:25:38

ay selena no les creas a todos yo soy tu fan numero 1 eres de poca ay como kisiera ke fueras mi hermana ay eres super te juro ke te kiero mucho AHAHAHAHA kiero ir a estados unidos soy de Nuevo Leon monterreal escobello ay te kierooo ahaha le mi nota kisiera ser como tuu tu pelo como actuas como te viste ai te kiero

Publicado por mariana at 07/03/10 00:50:33

selena es la mejor,y la mas guapa.Porque miley es una mandona y una pija,sin ofender.Para mi selena.

Publicado por anonima at 07/03/10 09:21:08

olas hanna montana soy tu almiradora numero 1 me encanta tu serie haaaaa y selena gomez es una estupida no te llega ni en los talones. tu eres la mejor cantas hermoso claro y demi se cree la gran cosa ella es otra tonta deberia lustrarte los zapatos miley hanna montana son las mejores viva por ellas.te dejo mi correo hanna montana,me llamo allison.allisonyb_lachinita@hotmail.comadios no olvides eres sensacional.

Publicado por allison at 07/03/10 11:26:18

selena eres inbesil cara de poto.

Publicado por allison at 07/03/10 11:27:53

demi es fea y tonta.cara de rana

Publicado por allison at 07/03/10 11:29:03

miley es la mejor eres genial.

Publicado por allison at 07/03/10 11:30:23

ay chicas me encantantan son re lindas selena me re gusta como actuas en la pelicula de programa de protecsion a princesas y demi miley me encanta tu programa y la de tanbien de selena y de demi la peli de programa de protencion a princesas

Publicado por aldana at 07/03/10 14:04:26

SELENA GOMEZ es la mejor q todas de disney channel porq la tonta de hannah se burla del espanol hannah montana BASURA OK y demi tu seras la q se llevaras el segundo lugar DIOS TE BENDIGA SELENA GOMEZ chauuuuu

Publicado por Isabel Juarez at 07/03/10 19:54:30

Selena es la mejor Dios la bendiga

Publicado por Isabel Juarez at 07/03/10 20:17:10

hannah montana y selena gomez son misidolas adoro su programa y tengo sus discos soy una gran fan de su serie yde ustedes espero su respuesta y selena yhannah llamenme minumero es 3111016327 ablo español y me llamo estefania y el que diga lo contrario es una pedeja como tu stephany BAY LOS QUIERO

Publicado por estefania at 08/03/10 10:37:05

pues la mejor es selena gomez mi orden es selena gomez ,demi lobato y milei

las critica para miley :es estupida,tonta,puta,loca,diabolica,y mas puta jajjaj me cay gorda miley aaayyy la odio es una puta se cre la muy muy

las critica para dimi lobato:es odiosa
y enkanbio nuetra ultima es selena gomez
las criticas para selena gomez:es linda ,ermosa,bella talentosa tiene una bos ermosa es mas linda ke miley y demi i es es mi desision selena gana la amo

Publicado por beida gomez at 08/03/10 17:36:13

estan locas?? selena gomez le robo el novio a miley cirus y demi lovato es buena pero es amiga de la bruja de selena gomez esa tarada ¿quien se cree que es? se hace la linda en los hechiceros de waverly place no existe selena ,viva miley es la mejor. besos..!!!

Publicado por jasmin at 08/03/10 18:20:58

hola selena yo bote por ti porque eres chistosa;alegre;buena actris ademas eres la que mas adoro en ete mundo de famosas. hola mayli yo no bote por ti porque no eres tan alegre como selena gomez tampoco eres alegre eres bellisima pero lastima:(
hola d mi yo no bote por ty por me gusta selna gomez por ue es mas linda que tu en tu cara ydiota;fea;estupida . mentirosa. ala que escogui como fea tonta:demilovato ala que linda myli ala linda de todo selena gomez y te quiero desir que con mucho cariño selena bote por ty y muyli no tepongas triste total ygual eres bonitaxd.

Publicado por monserrat at 08/03/10 21:15:23

Demi lovato es la mejor!!!!!

Publicado por pauli at 09/03/10 09:14:36

mileeeeeyyyyy y demii no esa putaa de pelela gomas visiten blog antiselena gomes esta buenisimo

Publicado por ariiii at 09/03/10 11:59:08

eres muy bonita selena poreso te e elegido

Publicado por vanessa nicol at 09/03/10 19:52:09

demi lovato es la mejor sin duda vamos

Publicado por marta at 10/03/10 11:09:00

que lindo

Publicado por carolina at 10/03/10 15:09:18

te amo selena gomez
sos mi idola deserio

Publicado por maitena at 10/03/10 20:52:13

hola chicas para ami demi es la mejorr las otrs son feas envidiosas por que demi ees la mejorr y siempre le va a ganar alas otras 2 bueno aguante demii es lo mas iigual que mua alas otras 2 las kiero pero a demi loveto es mejores que todas juntas y despues esta miiley y despues selena yo la odio muchooooo muchoo bueno chicas nada mas que decirless chau y pasen por mi metro

Publicado por miriam at 11/03/10 19:06:47

la mejor es miley cyrus y despues es selena gomez y por ultima es demi lovato la mas sosa

Publicado por anonima at 12/03/10 11:55:54

selena sos la mejor en todo del mundo te adoro tu seguidora numero 1.


Publicado por oxana at 13/03/10 15:23:15

todas tres son las mejores quiero que todas sean amigas y tambien con beyli la de zac i cody porque juntas serian las mejores

Publicado por tania at 13/03/10 16:27:12

m... la mejor es selena gomez ,demi y a lo ultimo miley cyrus
kreo k es asi x k selena es la mejor
y despues demi x k miley es la ultima jejeje

Publicado por hilary at 13/03/10 18:41:56

Te amo miley selena y demi besos muaaaa

Publicado por zeinab at 13/03/10 18:58:14

Selena eres la mejor cantas hermoso quisiera que tubieras un concierto en la arena monterrey porfa siii att:tu mas grande fan que !te quiere mucho!

Publicado por mariana at 13/03/10 19:40:28

Selena eres la mejor cantas hermoso quisiera que tubieras un concierto en la arena monterrey porfa siii att:tu mas grande fan que !te quiere mucho!

Publicado por mariana at 13/03/10 19:50:10

hannah la mejor cantan de pop demi y sele se Quedan afuera hannah gano la bota de oro

Publicado por pamela at 13/03/10 20:21:29

selena sos la mejor del mundo de rocio celeste gimenez y maria eva vizcarra pepa

Publicado por maria eva at 14/03/10 16:42:22


Publicado por MAYRAY NAZLETH at 14/03/10 17:21:24

para mi son iguales las tres pero mi favorita es miley y selena os kiero

Publicado por anonimo at 15/03/10 04:03:56

hola queria decir q SELENA GOMEZ ES LA MEJOR DE LAS CANTANTES, miley cyrus es una tarada y no sabe cantar es un ascoo!!!!!

labensen la boca con jabon el q habla mal de ella...okis




Publicado por MARY LO +. at 15/03/10 19:20:22

hola chicas para mi miley es la mejor es super divertida es amigable chistosa
y me gusta mucho la seria hannah montana
soy su fans nùmero uno me gusta como canta y actua

Publicado por vielka at 16/03/10 16:21:12

oseaaa... selenaaaa es la mejoor buenooo que demiii tambn noo perooo para mi es selenaa s la mejor

Publicado por gabriiela at 16/03/10 19:47:48

bueno todas son bellas pero la q mas me gusta es selena gomez a mi me gusta la sorisa de elle vivo en venesuela en san carlos

Publicado por michelle at 17/03/10 07:23:17

por favor quien save el numero de selena gomez o el e-mail!! please lo necesito!!!!! gracias

Publicado por da_ga_ at 17/03/10 10:05:09

demi nose porque vas perdiendo si eres la mejor bueno selena tambien es buena pero miley cirus no por dios canta bien pero ella debe ir en segundo lugar mira asi quedo la encuesta que hice en mi escuela demi gano con 300 votos selena en el 2 lugar con 250 votos y miley cirus con 100 votos que demuestra que demi es la mejor de todaasssss

Publicado por fatima at 17/03/10 15:51:30

las 3 son relindas

Publicado por mariana at 19/03/10 10:59:15


Publicado por yainibel at 20/03/10 11:24:31

me gusta selena y demi. yo tengo su cidi de demi y me gusto la cancion two world all collide

Publicado por greta at 20/03/10 15:03:52

ps la verdad las 3 son las mejores son una grandes actrizes y es mmejor asi
ademas son rivales por tontadas bueno ps ahora se estan acercando mas y es lo bueno apoyo ala tres son las mejores
me encanta los hechiceros de weverly place, hanna montana, y sunny entre estrellas so lo mejor
selena, demi, miley[hanna]

Publicado por naomi at 21/03/10 01:08:05

hola soy agos y creo q demi es la mejor xq miley cirus es una puta va a salir en sex and the city re puta e pero demi es lo mejor

Publicado por agos at 21/03/10 15:16:02

yo soy la fans de demi y selena pero mas de DEMI LOVATO la amoo uuh si la amooo uhhhhh DEMI DEMI DEMI UH DEMI VATAA POR DMEI

Publicado por kelly kelly osuna rauiz at 21/03/10 18:40:30

nada miley te odiooooo sele te amooooo y demi teeeee reeeee quiero son lo mejor que se me cruso en el camino y nunca las olbido lasssss amo a laas dos

Publicado por valentina at 21/03/10 19:43:54

pz ya ni k decir vdd
pz pork miley es la mejor aunk tambien
la mejor es
SELENA GOMEZ yo voto por las 2 ya la k keda al ultimo es DEMI LOVATO ella no es
tan bonita como MILEY Y SELENA
pobresita me gustan las canciones de DEMI pero ella es un orror osea no la comparen con MILEY Y SELENA ellas 2 son
unas super estrellas de disney y eso las ase aun mas famosas wau disfrutenlo chicas es lo mejor k les puede pazar osea nunca se separen de la musica ni de sus series piensen en sus fans plis las amo a demi lovato nop bye

Publicado por miley miranda at 21/03/10 21:22:04


Publicado por ANDREA at 22/03/10 23:07:50

Hola demi,hana y Selena,soy fan de ustedes,las quiero , les mando muchos besos Jimena

Publicado por Jimena at 23/03/10 22:04:36

ggggguuuuuaaaaauuuuu que guapa estas selena gomez y demi soy fan tuya y de selena no tanto pero a lo que yo estoy es a esto de que dicen que selena esta celosa de miley cirus por que anda con nick

Publicado por paola maradiaga at 24/03/10 09:30:27

las quiero mucho

Publicado por paola flores at 24/03/10 09:36:27

las re kiero las amo

Publicado por luly at 24/03/10 10:29:16

hola hanna hola selena y hola demi lovato yo soy su fans y me se casi sus musica selena estubiste muy bien en el video de la princesa y demi lovato tambien haaaaa hana te adoro cantas re bien no sabes las quiero a las tres no soy como otros no soy fans cualquiera sos la mejor no saben cuando sea yo grande quiero ser como ustedes me agregan en su msn tengo 9 años

Publicado por sofia sosa ayelen at 24/03/10 15:17:00

boten por demi o sel no miley o
hanna tontana

Publicado por diana at 24/03/10 18:52:21

me encantan las tres pero mas selena y demi soy una gran fan de ustedes¡¡¡ SON GENIALES¡¡¡

Publicado por liz at 24/03/10 21:16:48

selena gomez eres la mejor cantante de mundo

Publicado por celia at 25/03/10 03:34:36

ami me gustan las tres son geniales e.e jejeje selea q linda es tu bos la tuya tambien demi las qiero como amigas que son ustedes eso

Publicado por marta lualdi at 25/03/10 12:16:25

selena demi ustedes son geniales ji las qiero como amiga qisiera poder estar en unos de sus consiertos y sus series jiijhaidjlid me da mucha risa porsiacaso esto jiijhaidjlid es una risa jijiji tengo diferentes risas bueno chaaaoooo ¢¾¢¾¢¾¢¾¢¾¢¾¢¾¢¾¢¾

Publicado por natasha at 25/03/10 12:21:35

olaa yo soy fan de selena gomez y de demi me encanta como cantan las dos y myley canta orrvle la odio

Publicado por carolina at 25/03/10 12:30:18

a mi megusta selena gomez por que es una muy muy buena persona tambien me gusta demi poro a mily cyrus la odio por que es un tonta

Publicado por victorio at 25/03/10 16:54:41

buenO LAS 3 estan bn

perO la mejOr es
'selena gOmez'


Publicado por Biiee at 26/03/10 09:15:07

maily cirus alias hannah montana
y selena gomez son las mejores
voy a seguir todos sus pasos:
cantar,bailar,besar a famosos...
las adoro son las mejores

Publicado por enola at 26/03/10 09:46:32

hola chicas soy su fan numero 1 me llamo enny y un dia kisiera berlas en persona bayyyyy

Publicado por enny at 26/03/10 10:08:12

las adoros son mis fan numero 1 las amos si desean tener un chico lindo solo llamenme soy linda aqui les dejo mi messenger

Publicado por lesdiby at 26/03/10 16:13:53

las mejor es la puta de la demi lovatto que me quito a nih yo ya ise el amor con el y fue bien rico y el medesi tocame el pene y yo se lo toque y estaba bien rico

Publicado por yoselin areli at 27/03/10 15:23:10

las mejor es la puta de la demi lovatto que me quito a nih yo ya ise el amor con el y fue bien rico y el medesi tocame el pene y yo se lo toque y estaba bien rico

Publicado por yoselin areli at 27/03/10 15:23:10


Publicado por AGUSTINA at 27/03/10 16:49:20

chicas para mì la mas linda es selena y es obvio es una de las mas lindas bueno chauuu besos grandes soy de argentina y respondan

Publicado por ludmila at 28/03/10 00:41:55

adoro a selena gomez por ser tan guapa y tan buena actriz

Publicado por sara at 28/03/10 04:22:29

selena gomez molas eres la mejor y muy muy wapaaa

Publicado por lidia at 28/03/10 04:27:38

demi eres la mejor y gual selena gomes y maily cruz las quieros

Publicado por paulina at 28/03/10 12:48:30

las amo son todo para mi tengo todo de ustedes soy su fan numero uno.
si quieren una amiga q las acompañe busquenme a mi porfa siempre juego a ser ustedes.
les doy mi msn

Publicado por lucia at 28/03/10 14:32:34

Heeii QeeOndaa seeLeennaa goomeezz deemmiiLoovaa lQmm<3 Qiisiieraa qoonooseerLas enn peersoonaa & seer
suu suupeer amiiGaahh Yaasee suueeeñoo deemmaaziiaadoo ) ajaja zooi dee meexiicoo,CooaahuuiiLaa enn AAQUUñaa;;
& sppeeroo uun diiaa veenngaann aaQaa mee muueeroo xqoonoozeerLaas ennzeeriiO mee enkkaanntoo prooteecciiOn para princesssaass;; lQmmmuuzhooo
ammm unn diiaa iree aLooss aangelez,mineezootaa eetcc; zllQmm


Publicado por jaakii at 28/03/10 15:10:37

weno yo soy fan numero 1 de los jonas brothers pero la qe me parece way es selena gomez ,canta superbien selena la mejor.

Publicado por lidia i love jobros at 29/03/10 06:42:51

weno yo soy fan numero 1 de los jonas brothers pero la qe me parece way es selena gomez ,canta superbien selena la mejor.

Publicado por lidia i love jobros at 29/03/10 06:45:51

selena es mi idola es mi ejemplo a seguir canta en ingles y español la adoro

Publicado por karla de lerman at 29/03/10 20:20:06

ola miley,selenay demi espero q esten bien las qero mucho soy fans de ustedes las quiero mucho

Publicado por angeles gabriela at 30/03/10 16:11:03

selena para mi tu eres la super super mejor...te admiro un monton me parece esplendido tu trabajo y todo el elenco de los echiseros de waverly place son lo maximo.....demy igual yo te admiro a vos peli proteccion a princesas, mejor dicho no podia haber mejores protagonistas q usd dos, todas unas princesas..las adoro y nunca cambien...un abraxot

Publicado por vianey at 30/03/10 16:18:41

demi,sele y miley sois las mejores ojala algun dia os pueda ver ¡ah! y por favor demi sele no os separeis nunca una amistad si es verdadera vale mas que todo el dinero del mundo por favor os manda un beso vuestra mayor fanXD

Publicado por paula marcos at 01/04/10 11:08:37

amo a miley es mi idola y los que deicen que es tarada y esoo no es vcerdad yo a miley siepre la ame y es la mejor la que canta mejor todos lo sabes la que tiene mas canciones y la mas idola y demi vi una foto y parese una vieja de 42 años pero ta con maquilaje solo es linda y selena nose tiene la cara chiquita es linda pero no se compara con miley la mejorr&#9829;&#9829;

Publicado por camila at 01/04/10 11:13:56

demi eres mi mayor fan y aunque aya mas votos para sele y a miley da igual los que te querremos te apoyan con todo su corazon.. eres la mejor me encantas y aunque vas perdiendo por sele y miley no te rindas lucha por la amistad de selena por que si no luchas significara que no fue una verdadera amistad

Publicado por paula marcos at 01/04/10 11:20:56

para mi demi es la mejor pero selena es muy linda y canta muy bien y por supuesto demi no se queda atras

Publicado por naty at 01/04/10 11:33:20


Publicado por NAOMI SAMANTHA at 01/04/10 22:51:58


Publicado por NAOMI SAMANTHA at 01/04/10 22:59:05

hello my name es demi lovato im favourite friends okey bay bay my friends demi lovato

Publicado por demi lovato at 02/04/10 10:44:58

nose para mki es mejor hannah pero no importa selena y demi son muy buenas ademas todos somos iguales las quiero mucho !!!.

Publicado por dana at 02/04/10 15:15:03

hannna eres la mejor te quiero pero como no voy a querer a 2 cantabtes maravillosas en fin ustedes son unas grandes famosas ylas quiero mucho sigan adelante1111!fans numero uno

Publicado por dana at 02/04/10 15:33:17

bueno hannah y selena son las mejores pero demi esta con joe jonas y eso no me gusta ademas demi es una vende patria idiota tonta inutil hannah montana es la mejor al igual que selena gomez me encantan las dos pero demi no me gusta como actua en sunny entre estrellas...

Publicado por leslie y madeline at 02/04/10 16:44:54

te quiero mucho y quisiera conocerte

Publicado por jasmin at 02/04/10 18:12:32

selena soy yo y mi prima es demi pero como no puedo votar dos me voto yo osea selena

Publicado por selena and demi at 03/04/10 03:15:31

hannah no es maravillosa es espantosa vale

Publicado por selena at 03/04/10 03:17:05

hellow im selena, and hannah o miley no siseren ok . is miley creasy, and demi is my best friend .and you and demi is the best .and hannah the best she´s creasy

Publicado por selena at 03/04/10 03:21:07

selena no es una estupida lo eres tu ija de puta un arcance te salga en el igado mala lavor ella no es la estupida lo es tu abuela

Publicado por aaaaaaaaaaaaaaa at 03/04/10 03:23:52

hola selena gomez eres la mejor y nunca cambies eres mu bonita y me gusta como actuas en los hechiceros de waverly place y demi me gusta como actuas en sony entre estrellas y espero que te la pases bien con tu amiga selena gomez si bueno bey las quiero muchote bay bey adios

Publicado por daniela at 03/04/10 09:57:04

hola selena eres la mejor yote descubri por mi hermana y a mi hermana le encanta hanna montana y yo dijo que tu eres las mejor bueno adios te me cuidas muchoooo selena y hannamontana

Publicado por daniela at 03/04/10 10:00:02

es mas buena sele porque es re divertida y re buena va buena asi de amiga ja pero es muy buena persona no es engreida

Publicado por Mica at 03/04/10 10:38:14

hello como andar usted?????'
yo ser mar- y y y o s e r u n a f ea

Publicado por MARY LO +. at 03/04/10 14:04:39

demi lovato porque ella es una chica sencilla linda ,buena , graciosa , y alegre con todos y muy positiva y selena tambien porque a mi me cae bien es chevere bye demi selena yo se q ustedes son las mejores

Publicado por sabrina at 03/04/10 15:33:16

para mi la mejor de todas siempre a sido selena gomez vamos es la mas wapa del mundo y la mejor que canta

Publicado por angela at 03/04/10 16:05:21

selena la mejor

Publicado por jazmin yasmin lopez at 03/04/10 16:46:00

hola chicas y chicos k aman a miley selena y demi ellas son muy bonitas bellas y todo pero les digo algo ley un comentario de una niña llamada agustina es una gabladora selena gomes tiene muchomas k ellas dos y selena ba ganando y demi ba perdiendo port k
selena tiene 3552 48
demi tiene 1664 22.5
miley tiene 2188 .296
vez niña es k nose solo les inporta la mas fea ademas miley tiene andanas en los dientes de abajo y demi tiene la cara como un huevo de cocinar y ademas miley lo k tiene son 16 años y selena y demi 17 ellas dos ban para 18 este año y ademasmiley ya en el 2011 ella no ba a tener fama ella se declaro asta ese año asi k si ella se ba se fue pero selena no canta como de 6 años ella no tiene seis ok

Publicado por brunilda lisbeth gonzalez at 03/04/10 16:56:57

hol soy deinis sele esres la mejor te adoro quisiera conocerte en person si te veo en persona me desmallo

Publicado por DEINIS PAOLA at 03/04/10 19:01:45

a mi me gusta selena gomez y miley cyrus pero no se cual es la mejor para mi son las dos demi lovato no me gusta tanto por k en sunny entre estrellas parece tonta

Publicado por inmaculada at 04/04/10 10:11:20

hola celena soy celeste tengo 10 soy una a almiradora tuya te quiero mucho yo cele

Publicado por celeste at 04/04/10 12:29:08

celena me llamo celeste soy tu almiradora sos la megor celena te quiero mucho yo celeste

Publicado por celes at 04/04/10 12:37:08


Publicado por YASMIN at 04/04/10 14:57:18

demi lovato, selena gomez y miley cyrus o hannah montana son muy bonitas y muy exitosas demi te felisito porque la peli de camp rock esta muy chida y de ti selena me encantan tus cansiones y por ultimo miley cyrus me encanta tu serie de hannah montana y tus cansiones la que mas me encanta es la de party in the usa las adoro y suerte.

Publicado por maria fernanda at 04/04/10 16:11:37

me encanta ver actuar a demi en sunny, proteccion para princesas (selena gomez actuo muy mal, me cae... no muy bien...) y camp rock, también me cae bien miley, soy fans de ellas 2, por el contrario, como lo menciono antes selena gomez no me cae muy bien... es muy fea para mi opinion, yo le doy un uuuuu a selena gomez que actue mas natural...

Publicado por Karolita at 04/04/10 18:08:05

hi celena gomez my name is gianella me gusta cmo actuas quisiera q seas mi hemana bye un kiss !!

Publicado por gianella at 05/04/10 19:56:10


Publicado por NOSOTRAS B,M,D at 06/04/10 14:59:20

la 3 son muy coooool pero akien adoro es a
es muy linda a mi primo le gusta
selena,y a mi hermana
bueno chao

Publicado por jessica at 06/04/10 17:43:45

yo creo q selena es la mejor de las tres es super linda y se viste espectacular y luego demi pero miley es una tonta boba q se valla a un pantano me da asco y quien la quiera tambien besos

Publicado por laura at 06/04/10 19:54:35

ps selena gomez eesa la mejoor de todaas xqe ees la unicaa qe no se a desnudadoo o algoo asii & aprtee lleva mi mismoo nombre

selena mabelt santillan torres

Publicado por selena at 07/04/10 23:03:11

selena es la mejor soy tu fan selena

Publicado por caro at 08/04/10 12:23:45

para mi la mejor es sel por que es muy simpatica

Publicado por tatiana at 08/04/10 13:50:11

ola demi lovato es la mejor de todas
bueno demi yo te qiero decir q yo soy tu fans y espero q vuelvs a peru(lima)ok bye mandales saluidos a sterling knigth porfa si bye cdtmmmmm.

Publicado por maria angelica santi migo at 08/04/10 16:37:25

hola soy eliana tengo 9 años tengo todas las musicasd de selena gomes y demi lovato
son mis idolasa las quiero a las dos

Publicado por eli at 08/04/10 17:40:26

me gusta mas selena gomez que demi lovato y mayli cyrus muchas personas le gustan selena o mayli o demi pero si le gustan selena gomez como a mi porque hablan mal de maily le gustarian que hablaran mal de ustedes

selena gomez lo maximo es simpatica,linda y exitosa me gusta como actua besos chao....

Publicado por oscariagni at 09/04/10 10:11:34


Publicado por CAMILA LA HERMOSA at 09/04/10 17:49:15

hello pero hannah o mayli es lo mejor que hay pero cual es el flow ella es the best.... perdoqui pero sele y demi son buenas pero no mas que hannah.....
hannah esc un amorrrrrsote.. soy tu fan numero una tengo todas tus cancionessss no me falta ni unaaa oseasssss

Publicado por janiela at 09/04/10 20:28:16



Publicado por aLeJaNdRa at 09/04/10 20:59:22

Adoro a Selena Gomez a Demi Y a Hannah son las mejores las quiero sigan a si y aproposito cuando vienen al Perú

Publicado por María at 09/04/10 22:21:57

selena gomes y hannah montana son las mejores y guapas

Publicado por marina at 10/04/10 11:23:53

soy la mejor admiradora de hanna montana haaaaa , y de selena a y no me tengo q olbidar de demi la tres son muy lindas y tienen mucho talento me gusata como cantan hay q tota se hac la q
quie es ella pra desirno nenas les mando un beso a toda la Argentina

Publicado por sofia at 10/04/10 13:13:50

selena es geneal es una chica guapa canta geneal demi es muy vonita mayly tambien pero para mi la numero 1 es selena gomes x ke a ella no le importa k digan de ella x ke solamenye se enfoca en su carrera sigue asi y vas a yegar muy lejos vamos selena

Publicado por estrella at 10/04/10 16:12:00

selena es la mejor de todas y despues sigue demi lovato . hanna apesta osea

Publicado por noemi obando at 10/04/10 16:15:03

Miren idiotitas aqui la mejor de todas miley o esque estan siegas a y por sierto ballanse a la a sus casas tontas bay lo siento estoy alterada por ustedes

Publicado por Gregvi Maria Vilcez Aguilar at 10/04/10 18:48:39

Hola Selena. sos la mejor sos buenisima soy tu fan mumero uno pero en los hechiceros ademas de ser la mejor y la la buenisima la protagonita. desde mis seis años que te conozco.

Publicado por luciana at 10/04/10 19:20:58


Publicado por ANGELICA PATIÑO at 10/04/10 19:23:37

hola yo solos les pasaba a decir que meliy y demi son loas megores selena no me cai muy bien pero me gusta su cansion de natury no me cai buen por que siempre quiere andar con todos y no hacia bonita pareja con nick jonas la bonita pareja era meliy y nick y espero que los jonas.demi .y meliy vangan a mexico su consierto pase en disney chanel y los jonas brothers son los megores del mundo su musica esta bien chida y no inporta lo que diga la gente es que les tuenen enviddia que su musica es chida y espero que nick y meliy sean todabia novios si no tienen que volver por que hacen bonita parejsa y si estan de hacuerdo pongan su comentario para que nick y meliy sean otraves si ya no son novios y hariba demi,meliy,y los jonas abajo selena gomez apezta a huevo podrido

Publicado por lizbeth at 10/04/10 20:27:38

me cay tan gorda esa RUBY FALZA de hanna montana no le llega ni a los talones a la selena gomez y a demi lovato
yo no se por k les gusta mucho esa RUBYA FALZA ojala y se le caiga la peluca.

Publicado por dinorah at 11/04/10 19:52:25

acthuan creeo q bien cada una thiene lo suyo pero se q de repenthe a demi acthua de mas y y a no se ve than bien el papel,a selena como q acthua super bien pero como q es bien engreida asi como q ase cosas por la genthe pero es mui exigenthe y hanna pues tambien me agrada como acthua y como q no es than exigenthe y esq thodos somos iguales y pues a ellas talves de ves en cuando se les sube la familla pero las tres caen bien mas sele y hanna,espero q su carrera llegue mas lejos y por favor dejen de aser chisme por ellas mas con sele y miley si thuvieran problems por romances no agan chisme es problema de ellas como q ya estan grandecithas.

y se qjan q aveses ya no kieren dar entrevistas y les grithan a los paparatziz

bueno cuidense

Publicado por paty at 12/04/10 12:20:46

Hola soi evangelina me encanta como cantan las tres a mi amiga le encanta Hannah pero ami me encanta las tres Hannah,Selena y Demi ¡son las mejores!

Publicado por evangelina at 12/04/10 13:31:19

I you love hannah montana.
I you love selena gomez .
I you love demi lovato .

Publicado por sofi at 12/04/10 18:57:44

I you love hannah montana.
I you love selena gomez .
I you love demi lovato .

Publicado por sofi at 12/04/10 19:01:35

selena y hanna son mis faboritas las amooooo valen 100000

Publicado por fernanda at 14/04/10 16:03:10

ustedes 3 son las mejores

Publicado por yessica manuela at 15/04/10 16:38:14

yo soy fanatica de las 3 selena como avtuas de ales para una niña buena ser tienes que aserf a el creser hannah tu cvomo actuas con miley dos mundos como dises que dijiste y ndemi en somy esres grasiosa chequealo que son jeniales agregenme a

Publicado por evelin at 16/04/10 22:21:44

yo soy fanatica de las 3 selena como avtuas de ales para una niña buena ser tienes que aserf a el creser hannah tu cvomo actuas con miley dos mundos como dises que dijiste y ndemi en somy esres grasiosa chequealo que son jeniales agregenme a

Publicado por evelin at 16/04/10 22:25:04

yo soy fanatica de selena gomes y demi
creo ke son lo mejor

Publicado por rosy at 17/04/10 11:47:25

bueno demi es muy hermosa tiene bonito cuerpo selena es bella tiene una sonrrisa bonita y hana montana es muy alegre y carismatica las 3 son presiosas ylindas.....

Publicado por kathy at 17/04/10 16:12:57

ola sho soy josefina osea la de patito thelma ines fardin a si k les doy las gracias

Publicado por thelma ines fardin at 17/04/10 16:42:23

olaaaaa hannah montana sabes que te kiero mucho eres mi fan 1 y para mi eres bonita y selena tambien y deni pero no como tu ni una yo vivo lejos vivo en guatemala vivo lejos por si quieres vinir a pasiar a guatemala mandame un correo yo te lo respondere.....chau las quiero alas tres son mis fansssss

Publicado por dayra samara at 17/04/10 16:58:17

hannah sos lo mas te queremos

Publicado por anonima at 17/04/10 17:20:37

demi eres una gran actriz y una muy talentosa cantante :) ;)XD
y de selena gomez, hannah montana y demi lovato
demi lovato y selena gomez son mis acrices favoritas.


Publicado por alejandra fernanda at 17/04/10 19:47:26

demi lovato es super buena onda igual ke selena gomez pero la berdad maily cai mal !!!!!

Publicado por karla at 18/04/10 17:26:29

selena es mejor que la pata de pollo(miley cyrus) y mejor que la chica buzon(demi lovato) selena es la mejor
¡aguante selena!

Publicado por agostina at 19/04/10 12:55:37

maily me encanta la miro todos los dias es una idola te quiero ,demi tambien y selena gomes es miidola desde siempre

Publicado por lucia at 19/04/10 15:06:13

Hola somos AGOS yBELU para nosotras la mejor es miley, las otras son lindas pero MILEY le gana¡¡¡VAMOS MILEY VOS SOS LO + TKMM. BYE

Publicado por Agos y Belu at 19/04/10 18:32:32

karla sos una gran tontita a mi mily me cae re bien ya q es la mejor y para tu informacion verdad se escribe con v corta. ok

Publicado por anonimo at 19/04/10 18:56:20

hola las amo un monton cantan rrrrreeequetebien en especial selena quisiera q me contestes te amo selena quisiera verte en persona te abrasaria te amooooo

Publicado por paula at 19/04/10 19:03:12

la más linda como siempre es miley cyrus

Publicado por magali at 19/04/10 22:24:35

me encanta como es selena yo digo q ella es la mejor no te ofendas demi y maley ustedes tanbien son bonitas

Publicado por frangerly at 20/04/10 19:28:00

Hola soy Mariana,y en mi opinion sel es la mejor, porque es ree buena y canta ree bien,ademas es re buena actriz,me encantaria conocerla en persona!!...
Tambien me gusta demi ella canta bien y es una buena actriz.
Pero en cambio maily no me cae bien,no digo que la ódie porque ella canta bien y todo eso pero prefiero a SEL!!

sel es la mejor ! bss

Publicado por Mariana at 20/04/10 20:02:54

Hola soy Mariana,y en mi opinion sel es la mejor, porque es ree buena y canta ree bien,ademas es re buena actriz,me encantaria conocerla en persona!!...
Tambien me gusta demi ella canta bien y es una buena actriz.
Pero en cambio maily no me cae bien,no digo que la ódie porque ella canta bien y todo eso pero prefiero a SEL!!

sel es la mejor ! bss

Publicado por Mariana at 20/04/10 20:06:16

hola demi y sele son las mejores y maly tambien pero no tanto demi novato y selena gomez son las mejores chauito

Publicado por maria pia at 20/04/10 22:55:24

hola hanah selena y demi las 3 son las mejores yo e ido al concierto de ustedes tres las quiero

Publicado por alejandra at 21/04/10 17:21:34

Ami me encanta selena pero .... Ay un problem selena esta muy fea en la foto ella tiene de preciosas porke pusieron esta?! Si no te guta la foto diga selena verde si te gusta slena rojo
Adios ... sabeys me paresco a emily osmen.

Publicado por Mery at 22/04/10 06:56:43


¡¡¡¡¡LA ODIO!!!!!

Publicado por MILI at 22/04/10 15:19:24

ustedes son unas cuerdas delokas
miley demi y sele son las mejores del mundo que ganen las tres las adoro me encanta como cantas sele y hanna como actua igual demi no te quedas atras demi

Publicado por yinger andrea at 22/04/10 21:03:51

Ola yo boto a maily cyrus
xqe es la mejor
pero la qe mas odioo
es a celena gomez
ii denii lovatoo
es bueno
pero es amiidaa
de la estupiidaa
de celena gomez
iio la odiio con toda
mii alma
a celena gomez
qe se ase la fiiera

Publicado por debo at 22/04/10 22:56:34

ola miley le odio a selena pero demi y vos son las mejores del mundo soy raquel de paraguay

Publicado por raquel at 23/04/10 13:07:59

hoola selena gomes tu papel esta rre copado en los echiseros te amo con toda mi vida soy tu fasn unemero uno te amo con toda i vida espero que sigas como sos linda , y se voo propioa te quiero muchioooo micaela jazmin screpanti

Publicado por micaela at 23/04/10 13:38:45

Love this picture more,miley,selena and demi ilove you my friends

Publicado por xochitl at 23/04/10 13:54:18

hola hannah sele y demi yo las admiro a las tres y me caen super bien y tambien los jonas a mi me gustaria q hannah con nick demi con kevin y sele con joe yo me veo todos los capitulos de los seis ademas emily me cae super tambien

Publicado por camila at 23/04/10 17:23:15

hana montana soy tu fans numero 1
y heres muy bonita y sigue
ciendo hana montana por ke tienes una voz
bueno te dejo con muchos vesitos de maria jose

Publicado por maria jose at 23/04/10 18:10:00

hola miley cyrus eres la mejor de todas este comentario es por que cantas super lindo tengo todos los discos tuyos porque cuando veas este mensaje mio de marlene sarai gomez marquez quiero que sepa que no se ingles pero se bailar muy bien y mi sueño es conoserte en persona y te dejo mi celular 5518818276 por si quieres conoserme mejor y te quiero con todo mi corazon

Publicado por marlene sarai gomez marquez at 23/04/10 18:46:42

hola selena gomes eres lo mejor io te admiro muxo

Publicado por PaOlA sUlLoN cAmPoS at 23/04/10 20:17:43

Hola,soy flor,tengo 8 años y tengo que comentar a las tres porque solo puedo votar a una sola.

Selena:me encanta como actuas en los hechizeros de waverly place,y principalmente como cantas.

Miley:me encanta mirar tu serie Hannah Montana,y me gustaria entrevistarte.

Demi:se como te llamas en realidad,Demetria Devonne Lovato,pero vamos al grano,me encanta como actuas en la serie Sunny Entre Estrellas,y tambien como cantas.


Publicado por Florencia Ortiz at 23/04/10 20:39:41


Publicado por valeria at 24/04/10 10:28:19


Publicado por Jonaticaaa 4 everrrrr at 24/04/10 11:11:20

la que dice que odia a miliy es una puta y una zorra y cojia y no es vrigen jejejejejejeje.yo adoro a las trez son mi favorytas osea son bella,lindas,hermosas,talentosas okkkkk :) ;)

Publicado por adeyali 123 at 24/04/10 15:26:27

selena gomez , demi lovato y maily son re lindas

Publicado por gimena at 24/04/10 15:53:49

miley, demi y selena son las mejores sus series uff nada k decir muy BKN las mejores las mas tops

a las 3 las kerooooo muach!

Publicado por muriel top at 24/04/10 19:18:00

hola chicas como estan espero q bien me llamo maria valentina vivo en colombia les quiero decir q son las mejores bye las quiero muaaaaa

Publicado por maria valentina gonzalez giron at 24/04/10 21:31:51

holita tus canciones son buenisimas
las tullas las de demi y asta las de selena yo tengo un grupo paracido yo soy miley mi amiga aye es demi y mi amiga pau es selena

Publicado por camila at 24/04/10 22:11:58

demi lovato es la mejor no solo lo digo por la forma como canta sino xq m gusta como actua y tiene una gran sinceridad en su interior q lo demuestra con sus acciones y las demas se mueren por tenerlo pero nunca seran como ella

Publicado por kiara at 25/04/10 02:09:53


Publicado por Jose at 25/04/10 02:14:01


Publicado por elita at 25/04/10 02:17:02

CONFIRM SOBRE LO Q DICEN SOBRE DEMI EN INTER Y SI ERA VERDAD veo q se `reocupa por los demas ella no es como las demas. mi voto es para ella.. joe es una gran chica la q as encontrado suertudo.

Publicado por andrea at 25/04/10 02:19:25

sele eres the best te quiero mucho tkm

Publicado por alba at 25/04/10 02:55:52

miley tequieroo eres muy linda y soy tuh superfan imprimo fotos tuyas i las cuelgo en el metroflog i mi habitacion ya no caben mas i mira que es grande todos me dicen que soy una gran fan porque todo lo que saco es de ti xdd 1000.0000.00000.0000. infinitos besos para ti :)

Publicado por cristina at 25/04/10 08:29:21

hola selena,demi,miley las tres sois las mas guapas del mundo y me llamo sandra y tengo a mis hermanas que se llaman ana y laura y os añoramos mucho y sois muy guapas las tres y nosotras hemos embiado esto y las tres sois las mejores xao

Publicado por sandra at 25/04/10 13:25:17

a mi me gusta selena gomez es bellisima ella es la mejor y demi tambiem pero miley es fea orrible SELENA CANTA MUY BIEN

Publicado por maria at 25/04/10 14:29:33

demi te vez muy muy muy muy muy muy muy muy bien megusto camp rock y me emociono cada vez qe escucho tu nombre pero no me gusta ni miley ni selena y tu voz me encanta

Publicado por Diana Victoria Briseño Espino at 25/04/10 19:16:13

demi te vez muy muy muy muy muy muy muy muy bien megusto camp rock y me emociono cada vez qe escucho tu nombre pero no me gusta ni miley ni selena y tu voz me encanta

Publicado por Diana Victoria Briseño Espino at 25/04/10 19:16:13

no pues la mejor es selena y despues miley y al final demi eso

Publicado por yoselinne at 27/04/10 00:49:24

a mi me encanta demi y sele son las mejores no se comparan con esa hannah es una idiota cuando canta tiene vos de hombre bueno demi es una diosa una estrella completa soy su fan y selena gomez es re chica re buena en muchas cosas amo programa de proteccion para princesas ja ja ja

Publicado por loreley at 27/04/10 08:54:14

demi y sele son las campeonas de todo son re buenas las adoro soy una fan botenlas no se equiboquen de loreley ciudad de mar del plata

Publicado por loreley at 27/04/10 08:58:11

ola es ovbio0 ke las tres son super la verdad no0 tengo0 preferencia co0n ninguna de las tres si ellas fueran amigas fuera super para to0do0s sus fans co0nsiderenlo0

Publicado por so0y iio0p no0 thu at 27/04/10 10:09:35

hola maily crus, selena gomez y demi lovato son las mejores del mundo me veo siempre su pograma y hasta me lo aprendi de memoria, y te cuento algo selena tengo unos primos de neiva que estan locos por ti bueno espero que me lo leas chao

Publicado por yomaira at 27/04/10 18:12:35


Publicado por INDRI at 28/04/10 21:32:38


Publicado por INDRY at 28/04/10 21:45:50

hola me llamo yadira quisiera conoserlas.

Publicado por Yadira Ysabel at 29/04/10 15:34:44

hola Maili cruz,selena gomes y deni lovato yo veo siempre su programa espero conoserlas hagun dia chau.

Publicado por Yadira Ysabel at 29/04/10 15:39:57

quiero a hanna montana esla mejor canta y baila.tiene un gran vos no como ellas

t e q u i e r o

Publicado por melina at 29/04/10 18:42:42

hola soy nadia y me encantan las3 pero mi faborta es selena gomez y la re pero re adoro mucho chau

Publicado por nadia at 30/04/10 10:27:16

quiero a selena gomes me encanta su musica

Publicado por nadia at 30/04/10 10:33:01

hola soy magy y estoy obsesionada co selena gomez puedes crerlo soy tu fants
numero uno selena gomez y me entanta tu nueva cancion de magic eres la mas bonita de esas tres

Publicado por magy at 01/05/10 09:24:32

bueno soy denuevo magy espero que entiandas algo i te mando mi correo bella princesa selena gomez eres la mas bonita de esas tres y te mando mi correo aver si algun dia quieres chatear con migo eres favulosa y veo diario tu programa bonita haci que te doy mi correo hermosa te quiero mucho selena bye

Publicado por magy at 01/05/10 09:38:50


Publicado por yadira at 01/05/10 14:38:42

hanna te amo!!
tu le ganas a esa boba de demi lobato ami las unicas artistas q me gusta eres tu y selena me veo todos los dias tu serie pero q lastima q lla te vas para tenesi bueno te dejo


Publicado por MeLiSSa at 01/05/10 19:41:20

hannah montana me encanta tu cancion theclimb es lo maximo q honda me facina
eres lsa numero 1 tu lo sabes nadie te ompra a ti tu eres la mejor yo todos los dias escucho tu cancion
bay helo hanis

Publicado por anthony at 02/05/10 09:33:21

hannah eres la merjor me encanta tu personaje en la peli y en el zapip soy tu fan numero uno

Publicado por yulianny at 02/05/10 11:59:48

las tres son las mejores del mundo sobre todo demi y sel

Publicado por stella at 02/05/10 13:36:05

klk selena denmi y myley son lo mejor las vennero algun dia quiero ser como ustedes 3 que dios las siga vendiciendo

Publicado por esmeralda at 02/05/10 15:41:42

hola selena eres la mejor TeAmO JI

Publicado por sofi at 02/05/10 16:54:14

me encanta como canta SELENA GOMEZ

Publicado por Rommy at 02/05/10 17:50:40

hola demi: te quiero desir que me encanta tu papel en suny entre estrellas y tu vos es grandiosa y hermosa y voss sos re presiosa soy tu fans numero uno te lo juro te quiero muchisimooooo si podria trabajar con vos trabajaría y seria tu mejor amiga y me encanta como actuas en protección para princesas y camp rock
hola sele: te quiero desir que sos hermosa y que me encanta como actuas en los hechiceros de warveli plays y en protección para princesas y soy tu fans numero uno

hola sele te quero desir que tenes una vos hermosa y que me encanta como actuas

hola mayli : sos fea te odio porq yo se que te llevas mal con demi y sele y actuas muy mal te detesto sos re tonta te odio y si tengo que trabajar con vos no pienso trabajar te detesto chau ni te quiero hablar chau

las adoro demi y sele pero no a hanna

Publicado por melina at 02/05/10 20:11:17

yo obio voto por demi lovato te amo demi ahhhhh

Publicado por melina daniela samat at 02/05/10 20:20:16

Hol@ soy florencia perdomo y yo voto x las 3 son las mas mejores del mundo las amo me moriria si las pudiera ver en algun lado. A@@@@@@@@,Ustedes saben que algunas personas en el mundo son pobres bueno yo soy una de esas,si tuviera cable las miraria a todas las series de Hannah Montana,Demi Lovato y Selena Gomez las qiero mucho mucho mucho mucho chau Bess a las 3 el cel de mi madre es: 095146626 a y mi color favorito es el bioleta y mi numero es el 7

Publicado por Florencia at 03/05/10 11:02:38

te quiero myley

Publicado por sofi at 03/05/10 17:01:18

ola demi soy tu mas grande fan en todo el mundo me llamo Maria Eugenia soyde uruguay te quiero mucho!!!!

Publicado por Maria Eugenia at 04/05/10 14:28:31

hola miley como ests espero que algun dia te pueda conocer y eres muy buen actriz y felicito eso y tambien sabes cantar fabuloso te quiero miley bye y espero que puedas ver mi comentario bye

Publicado por dara at 04/05/10 15:01:14

las 3 son super pero mis preferidas son
demi y miley son super y amo su musica 1 beso a las 3, te admiro mucho miley rtes super, igual a demi y selena

Publicado por barbaraserricueta diaz at 04/05/10 15:08:45

hola soy fants de las tres y me encanta como cantan pero soy fants numero uno de selena gomez y creo que eres la mejor eres mi modelo a segir besos a todas tres espero q me escriban

Publicado por ana lucia at 04/05/10 18:40:37

ola llo elas dos a demilovato y a selenagomez por ke la pelicula de programapara proteccionpara prinsesas eslamejorpelicula

Publicado por alma at 04/05/10 22:50:40

hola demi me gusta mucho suuny entre astrellas ami megusto el capitulo donde tienes q besar chat t.q.m

Publicado por anonimo at 05/05/10 11:15:09

selena eres la mejor me encanta tu estilo y como cantas eres maravillosa vesos att ana

Publicado por ana lucia at 05/05/10 16:23:26

ola selena gomes yo soy la mayor fans y tu eresz tan linda bueno chaooooo yo soy tan linda komo eres tu chaooooo ¡¡¡¡¡

Publicado por khrissna quilodran at 05/05/10 17:45:49

hola miley cyrus jajaja todas son feas jajajaja

Publicado por brenda at 06/05/10 10:41:26

ola quiciera ser asi cm ustedes de bellas pero lastima yo soy muy fea a mi nadien me quiere solos mi familia

Publicado por radilmar at 06/05/10 11:01:48

sel te admiro mucho ss la mejor

Publicado por romina at 06/05/10 17:47:08

selena es la mas linda obio
sisisi bueno tambien demi y despues hanna
me encanta los echiseros de gauart
y me gusta la pelicula que isistes con demi programa de protecsion para prinsesas bueno soy tu fans numero 1 bueno chau.

Publicado por camila at 06/05/10 17:53:30

hola demi lovato heeEres la mejor de casi todos los cantantes del mundo te kisiera conoser me llamo dulcc? kisss??

Publicado por dulce at 06/05/10 19:28:49

holaaa soy carla mi9 artista favorita es demi lovato es la m,ejor cabntante del mundo soy muy buen fanatica de elle tengo su cd boten por demi

Publicado por carla at 07/05/10 18:53:08

holaaa soy carla mi9 artista favorita es demi lovato es la m,ejor cabntante del mundo soy muy buen fanatica de elle tengo su cd boten por demi

Publicado por carla at 07/05/10 18:54:40

bueno yo solo puedo de cir a solooooo una y de cido aaaa demi por q myley no me cae muy bien y tampoco su nuevo novio iiu y selena la odio!! q horor vayanse no me gustan para nada solo de mi me encant como canta yyy me gustaria conocerla su serie sunny entre estrellas me encanta si aciendo musicas... bay demi

Publicado por c arla veronica at 07/05/10 19:02:11

hola hannah montana soy tu fan y te quiero muxo yme gusta ver tu programa es super te quiero bayyyyy ybesos
hola demi taqmbien te adoro y mi amiga tambien hola selena tu y hanah hiciero muy buen equipo en mikeila y hanah montana y las tres son buenas en amigos por el mundo las quiero bayyyyy recuerden soy su fan espero que lo lean porfisssss besos

Publicado por mitsui at 07/05/10 21:53:18

hola soy tu fan #1 hanna dejame qe te digo qe veo todos los dias la serie my favorita es cuando lili descubre tu identidad de hanna y cuando0 o0liver tambien cuando no le gusta le chicle bueno adios espero qe estes bien te cuidas a saludos para tu Papa,Yacson,Lili,Oliver y Rico.

Publicado por crystal at 08/05/10 17:53:35

hola demi lovato sos mi fan te re quiero mucho te doy mi emeseene mikasimplemente@hotmail y me gusta tu cancion de dicisuui besosssss

Publicado por micaela jimenez at 08/05/10 18:18:04

ola demi, selena y hanna monthana ustedes son super cool :) ;) saludos de mi y de mi amiga daniela dise k son per fectas yo tanbien lo digo eeeee saludos ¡BAY!;)

Publicado por KARLA at 08/05/10 18:24:13

ola hanna,demi y selena me llamo isabel me gustaria concerlas, ustedes son mis fans numero1, y me gustaria tener sus correo de ustedes.
mio mi correo es

Publicado por SHANDRYKA ISABEL at 08/05/10 21:00:13

aguante selena gomez y argentina

Publicado por aldana at 09/05/10 08:25:13

ami me encanta miley o hannah montana canta perfctamete y es la mejor de todas. Besos a las dos

Publicado por maily at 09/05/10 10:30:35

demi novato es mi super cantante del mundo la super mejor y selena gomes se cre la presumida

Publicado por lizbeth at 10/05/10 16:35:24

para mi la mejor es selena gomez porque es la mas linda y popular¡¡¡¡¡

Publicado por camila alvarez at 10/05/10 19:38:38

para mi la mejor es selena gomes porque es talentosa y tiene mejor gusto .Tambien es la chica mas hermosa de y tambien creo que miley o hannah montana es presumida y en alguno de sus papeles parece una tonta haci que sige haci selena eres super hiper mega fabulosa

Publicado por estefania at 11/05/10 10:28:20

soy una fan de ustedes pueden venir al colegio inem felipe peres claro con permiso del director estamos en pereira

Publicado por martha liliana lenis herrera at 11/05/10 18:00:59

ola amo a demi y a selena nada q` comentar chao

Publicado por lorena at 11/05/10 19:56:51

me encata selena y demi y la mili esa es tonta

Publicado por sara at 12/05/10 01:39:14

pues..... yo creo que Mailey Cyrus es la mas porque Demilovato : ademas de ser feisima..... nisiquiera canta bonito y Selena Gomez es solo una cara bonita queç ademas hev oido que algunas canciones nisiquiera son suias ..y ademas Mailey Cyrus canta genial es guapisima y es super dulce.....asi qwue lo siento pero en fion con Selena no tengo nada pero con la perra de Demitomatepodrido esa estupida que ademas de ser feisima tiene una sonrisa horripilante! asi que chauuu estupidas y hello the best star Mailey Cyrus

Publicado por anne at 12/05/10 05:41:25

hola soy celeste de san juan y les quierop decir que me encanta el programa de las tres los hechiseros de weverli place,sunny entre estrellas y hanna montana bueno me tengo que despedir
chauuuuu¡con un besote y un abrazo

Publicado por celeste at 12/05/10 11:58:07

la mejor es selena gomes poque es re linda.....y canta re lindo....mailey cyrus es linda me gusta,me gusta como canta.....todo,y demi lovato tambien es linda todo,pero selena gomes las pasa a todasss bueno ya dije todo lo que dije.....chauu demi lovato la mas tonta,chau mailey sirus orriblee,y chauuuu selena gomes te quiero mucho sos la mejorrrrr soy una de tus mejores fans del mundooooo ,creo que soy la unica....jajjajjajajajaaajjja

Publicado por florencia at 12/05/10 14:41:21


Publicado por brenda at 12/05/10 18:41:36

hanna montana es muy estupida es mejor demi

Publicado por sandra at 13/05/10 11:08:56

Miley!! para My Miley es la mejor selena solo es una robaovios!! una cruella de vil! Smiley todos te apollamoss!! Bsos

Publicado por Miley at 13/05/10 17:37:51

hola soy carolina admiro mucho demi lovato me gusta su voz y por lo muy bonita tengo 10 años megusta la cancion de canrodpor que cantas conlos jonas bros

Publicado por yennifer at 13/05/10 19:36:53

hola como estas me gustais u chorro soy vuestra fan numero 1 tengo 10 años me llamo yeri gabriela uribe alzate

Publicado por yeri gabriela at 14/05/10 08:40:57

hola como estas me gustais u chorro soy vuestra fan numero 1 tengo 10 años me llamo yeri gabriela uribe alzate

Publicado por yeri gabriela at 14/05/10 08:41:42


Publicado por MAURELIS at 14/05/10 12:30:21

hola demi te amo adoro tus canciones y me gusta nas la de dicis di my
y me encanta el programa de sonny entre estrellas y camp rock y si conoces a los jonas me los saludas y diles que los amo muchisimo o claro ovio que a ti tambien

Publicado por libni at 14/05/10 14:56:19

sele te amo muchisimo te prefiero ati sele tu cantas super bien actuas de lo mejor por eso te dieron ati el premo de los kids choce a wards por mejor actriz de serie. en cambio demi tambien es muy buena pero la prefiero a selena.
pero miley no ni de chiste investigue en el internet y dice que se droga se toma fotos desnuda y demas cosa
ademas no sabe ni cantar bien su voz es como de una cantante de opera, no sabe actuar, actua como una adolesente muy caprichosa, mimada y creida.
selena la gana en actuacion y sobre todo en cantar.
bye selena soy tu fan number one 1.

Publicado por anita at 14/05/10 15:28:05

hola la mejor es selena y demi mayli ya paso de moda y la odio selena y demi tengan mucho cuidado com maili les puede quitra a sus novios

Publicado por roxett at 14/05/10 18:43:40

nda q vr q la q tenga mas votos sea la fea de selena gomez si las diosas aca son demi y miley obvio!!!!!

Publicado por gal at 14/05/10 22:46:48

yo creo q selena,demi y miley

Publicado por cristina at 15/05/10 10:36:31

mis favoritas son demi y selena quien va a querer a hana montana

Publicado por avril at 15/05/10 10:48:26

yo opino que selena es mejor que todas!!!!!

Publicado por estrella at 15/05/10 10:51:41


Publicado por MARIANNA at 15/05/10 12:29:19

hola me llamo yulisa y la verdad yo creo que todas son estupendas y no se cual es la mejor ,es algo dificil de elegir chao las admiro me encantan

Publicado por yulisa guerra at 15/05/10 13:21:24

mira margarita tuu lo que eres es una selosa,embidiosa po eres una tarada que esta mal de la cabeza bete para un psicologo idiota

Publicado por yulisa guerra at 15/05/10 13:27:12

hola chicas me gustan las tres perdo vote a hannah montana perdon y estoy escuchando camciones de selena gomez chau las quiero quiereo que me visiten rapido .....

Publicado por selena at 15/05/10 22:34:34

hola chicas me gustan las 3
1.Selena Gomez me encanta tu serie y como te bistes.
2.Demy Lovato me gusta tu serie q sos re chistosa y asen una buena pareja tu y Joe Jonas.
3.Miley Cyrus me gusta tu serie y me encanto tu pelicula y sigue adelante._
me encantan las 3 x lo q escribi anteriormente ademas son muy talentosas y las kiero muxo jeje

Publicado por Lisy herrera at 16/05/10 14:13:19

abril eres una tonta si dices que nadie quiere a hanna montana bye tonta de avril

Publicado por carolina at 16/05/10 14:27:26

os kiero a todas

Publicado por alba at 16/05/10 15:56:23

Hola yo soy la mas grande fan de Miley Cyrus porque tengo todas sus cosas hasta mi habitacion tiene todo de Miley Cyrus posters,ropa,el placard tiene todas fotos de ella toda mi habitacion esta rodeada de Miley Cyrus.Hasta uno de mis e-mails dice soy la persona mas fanatica en el mundo de Miley cyrus asi que si ustedes dicen que ustedes son las admiradoras de numero 1 de Miley Cyrus estan diciendo mentiras y no sean mentirosas.Gracias por toda su ATENCION.Chau.

Publicado por agustina at 16/05/10 17:55:03


Publicado por ESTEFANÍA at 17/05/10 05:42:27

yo creo que ls tres me encanta a demas demi es la mejor actris

Publicado por vanessa at 17/05/10 13:55:23

hoigan selena gomez demi lovato yo tengo 7 años y yo las e e visto en barney cuando tenian 6 años yo creo que si harian una votacion por selena gomez.demi lovato y .miley cyrus yo votaria saven por selena gomez por que ella es la mas hermosa de disney worlt y saben yo soy la mas linda de este pais pero selena gomez parese que es mas linda que yo y saben a mi me gusta de disney worl el joe jonas de jonas y aora estoy biendo brenda song de zac y cody gemelos en accion zac y cody gemelos a bordo

Publicado por belen at 17/05/10 20:20:37

selena sos rre hermosa demi sos muy hermosa y quiero que seas mi amiga myley quiero ser tu amiga y selena yo quiero tambien ser tu amiga las amo a las tre y algo mas son mis fans numero uno las tre chicas son las mas bellas del mundo y mi nombre es ailen y tengo 7 años quiero que lo sepan las tres las quiero mucho a las tres chau besos y cuidencen mucho besos ailen para las tres y algo mas mi msn es asi pero no se rian es

Publicado por ailen at 17/05/10 21:45:35

hola a las tres selena demi myley si las veo por cualquier lugar me moriria que las saludaria y las tres cantan bien y quiero que las tres sean mis amigas y son las mas hermosas del mundo bueno chau besos y quiero darles mi msn a las tres asi me ponen en su msn y es asi pero no se rian es bueno muchos besos chau a las tres

Publicado por ailen at 17/05/10 21:50:13

hola a las tres selena demi myley si las veo por cualquier lugar me moriria que las saludaria y las tres cantan bien y quiero que las tres sean mis amigas y son las mas hermosas del mundo bueno chau besos y quiero darles mi msn a las tres asi me ponen en su msn y es asi pero no se rian es bueno muchos besos chau a las tres y acuerdencen mi nombre es aylen pero pueden decirme ay

Publicado por ailen at 17/05/10 21:51:59

la mejor la verdad es selena pero actua mejor demi pero la verdad miley es muy chistosa y selena y nick asen bonita pareja no puede ser ami me gusta nick o no si me lo itan estan muertas pero espeto selena la mas bonita es selena luego miley y despues demi eso es todo por hoy les mando besos a nick,joe,kevin,selena,miley y demi los amo byebye cuidense ***ove you***byebye*

Publicado por yoselinne at 18/05/10 00:12:15

hello hannah call me target am of venezuela am your fans nurber one you adoro chaito

Publicado por diana requena at 18/05/10 17:22:01

hello hannah call me target am of venezuela amyour fans number one you adoro chaito

Publicado por diana requena at 18/05/10 17:26:28


Publicado por ANONIMO at 19/05/10 10:01:53

!Hola soy Rocio hami me encanta Demi Lovato ella canta hermoso desde JUJUY ARGENTINA TU MEJOR ADMIRADORA

Publicado por rocio at 19/05/10 15:44:05

los que piensa igual contesten porfabor

Publicado por ANONIMO at 19/05/10 17:31:56

yo adoro a demi y mas ahora que sale con joe jonas cuando tengan sus hijos
espero que sean muy felices y que se kacen hasta la muerte te adoro demi

Publicado por danna at 19/05/10 18:06:20

yo adoro a demi y mas ahora que sale con joe jonas cuando tengan sus hijos
espero que sean muy felices y que se kacen hasta la muerte te adoro demi

Publicado por danny at 19/05/10 18:08:48

me gusta selena y todas y soy su primer fans

Publicado por milli at 19/05/10 20:37:13

me gusta hannah montana miley cirus demi lovato selena gomes son tan lindas soy su primer fans de las tres

Publicado por miley at 19/05/10 20:42:05

te quiero mucho selena y demi lovato cantan re bien tkm tkm tkm tkm tkm tkm tkm tkm todo eso las qquiero chauuuuu!!!!!

Publicado por cande! at 20/05/10 15:36:27

bueno parami miley eres un asco te ODIO eres la persona mas orenda del mundo te odio abla porfas como mujer si ?
demi: eres la mejor te adoro eres una super niña te quiero mucho cantas super vien eres lo maximo y por ultimo sel: eres superrrrr te admiro un buen te quiero mucho soy tu fan nomer one tego todos tus discos te adoro eres la mejor demi y sel: la amistad k llevan es lo maximo las admiro muchos tego todos sus discos y poster demi t.k.m por k me encanta como actuas selena t.q.m por ser mi tocalla y por k actuas super bien miley te sigo odiando por k andas con nick jonas y el es de selena nick y sel 10000 amor nelena.linda pagina

Publicado por selena at 20/05/10 20:17:50

las amo chicas



Publicado por alma at 21/05/10 12:26:06

hola mili sos mi fans y tengo todas tus fotos

Publicado por milagros at 21/05/10 15:31:38

hola me llamo isabel y ustedes como se llaman

Publicado por isabel at 21/05/10 19:58:59

la verdad demi es la mejor pro selena me parece muy payasa nunk debio decir que demi no era su mejor amiga y q era taylor swwift cuando siempre decia q demi era su mejor amiga x eso me cae mal selena y bueno miley anda con todos y es muy payasa x eso yo voto w demi DEMI ERES LA MEJOR que no c te olvide q selena es una traidora

Publicado por alejandra jaral lara at 22/05/10 15:52:16

la verdad demi es la mejor pro selena me parece muy payasa nunk debio decir que demi no era su mejor amiga y q era taylor swwift cuando siempre decia q demi era su mejor amiga x eso me cae mal selena y bueno miley anda con todos y es muy payasa x eso yo voto w demi DEMI ERES LA MEJOR que no c te olvide q selena es una traidora

Publicado por alejandra jaral lara at 22/05/10 15:53:59

a mi me gusta selena gomez x que es mi favorita te mando muchos besitos selena gomez te quiero t adoro me llamo isa

Publicado por isabel at 22/05/10 19:29:38

devi lovato
haana montana
selena gomez
me gustan como contan son facinantes
su papes so ingreibles

Publicado por maria jose at 22/05/10 19:42:03

hola demi

hala maley

hala selena

ninguna de las tres es mi favorita
solamente que me gusta por igual como

Publicado por francisca diaz at 23/05/10 14:47:41


Publicado por oriana at 23/05/10 16:03:05

hola miley es hermosa pero no tanto como demi lovato y selena gomez

Publicado por ellie gineth taylor at 23/05/10 16:16:14

Demi tu eres la mejor de las 2 y eres bonita y bella

Publicado por George at 23/05/10 17:23:36

Hola Demi eres la mejor de todas

Publicado por George solis at 23/05/10 17:26:19

Hola Demi eres la mejor de todas

Publicado por George solis at 23/05/10 17:27:11

hola Selena gomes soy una de tus admiradoras te admiro tanto por eso eres la mejor de todas¡¡¡¡¡

Publicado por camila ayala at 24/05/10 09:54:33

Demi soy fans tuya me gustan tus canciones te veo en sunny entre estrellas y igual vi cam Rock y eres fasinante adios muchos besos chaooooo
-----de constanza
23/05/10 03:35pm

Publicado por constanza poveda at 24/05/10 14:27:48

hola soy valentina y quiero decir q miley cyrus es linda,buena cantante y buena actriz

Publicado por valentina at 24/05/10 16:36:36

selena gomez es la mejor ose hello a loveo sele

Publicado por alejandra at 24/05/10 17:43:52


No me agrada mucho selena por que estuvo en pareja con NICK JONAS...
Yme encanta demmi por que esta en relacion con JOE JONAS...

Aguante demi y hannah.....!!!!!..!!!

Publicado por ROCIO CENTENO at 24/05/10 22:38:26

son jeniales todas juntas las idolatro megusta soni entre estrellas ,los echiseros de gueverlipleis ,hannah montana la pelicula deustedes.

Publicado por javiera victoria at 25/05/10 10:41:56

miley la mejor :)

Publicado por danica at 25/05/10 13:21:00

hola demi y miley, a ti no te salludo selena por q me pareces horrible tarada cantas horrible , soy tu admiradora demi y miley las adoro.

Publicado por alejandra at 25/05/10 16:50:29

selena eres la mejor igual que miley las dos son hermosas soy su fan numero 1 y deby no me gusta porque no es graciosa mas bien no sabe actuar es orrible me gustaria deby si fuera mas graciosa desde entonces me gustaria pero es fea

Publicado por estefani at 26/05/10 13:48:37

Hola me llamo rocio y yo pienso que Miley Cyrus es la mejor de todas es mas bonita y canta muy bonito hannah montana soy tu fan 1º

Publicado por rocio del pilar at 27/05/10 12:11:02

no importa cual es la mejor las 3 son estupendas las amos a las 3 okiiiiis

Publicado por maria victoria at 27/05/10 13:09:12

Hola! Pues yo soy la mayor fan de Demi! Lo sé todo sobre ellaa! y, evidentemente, la he preferido a ella!!

Publicado por laura castillo at 27/05/10 14:40:12

hi selena.eres la MEjoR ME e GRabado TOdas TUS canciones eres LO MAXIMUSSSSS.....

Publicado por ANA at 27/05/10 15:44:42

yo soy silvia de la paz bcs mexico y me caii muy bien selena soy su fan numero1

Publicado por silvia maria camacho at 27/05/10 16:34:35

las dos son lindas para mi las quiero a todas son las mejores dios les bendiga mucho a ustedes y su familia...

Publicado por laura castellano at 27/05/10 17:13:54

yo cro que selena gomez y demi lovato son lo mejor de la musica pop pero miley syrus es una tonta loca fea pero se que alguna jente le gusta ami me gusta una gota de su musica pero ella miley es orrible cuando canta ase unas muecas orrible u.... no esque sea cuica pero es una opinion personal y posdata odio a miley

Publicado por javiera at 27/05/10 18:33:29

me gusta selena gomez porqe me encanta como actua,canta y es muy graciosa

Publicado por andrea at 28/05/10 13:31:34

selena gomez y myle cyrus son las mejoress pero demiii lovato es muy payasa

Publicado por andrea at 28/05/10 13:37:23

Selena gomez y demi son las mejores

Publicado por Abril at 28/05/10 15:24:14

selena gomes tkm amix mi idola te amo y alguna bes me gustaria conoserte soy tu fan numero 1tkm te amo adibina yo tambien me llamo selena me encanta nuestros nombres bey chaito y eres muy ermosa bey

Publicado por selena at 28/05/10 19:37:48

selena es la mejorrrrr su musica es la mas padre y ella es la mas bonita demi esta fea ve su barbilla esta toda partida no existe otra mejor que selena

Publicado por kary at 28/05/10 20:21:24

hola demi lovato eres mi idolo te quiero mucho adios

Publicado por cristina at 29/05/10 03:46:27

para mi Selena es la mejor me encanta como hace las peliculas los hechiceros de waverli place,la de programa de proteccion a princesas Demi me gusta camp rock y Miley me gus ta como hace el papel de hannah lo hace super,pero Selena es la mejor me gusta como canta me encanta tu musica Selena

Publicado por jenniffer at 29/05/10 10:25:31

Hoola opdio a patito feo, es la mayor mierda del mundo, me encanta demi lovato, soy su mayor fan en serio, no miento. Laura Castellano, esa opinión tuya me ha gustao, a mi me gusta miley un poquito, pero me gusta lo k has puesto sobre k es una opinion personal.

Publicado por otra vez yo at 29/05/10 11:02:28

maily eres la mejor del mundo

Publicado por paula at 29/05/10 12:44:56

hola ps miren nose ablar ingles como ustedes pero nunca me puedo perder sony entre estrellas ni hanna montana ni los herchiceros de waveli place bueno espero q luego me puedan agregar mi correo es bueno ya me voy bye bye se cuidan

Publicado por yoselinne at 29/05/10 13:43:11

me gustan todas pero la primera es demi despues selena y miley

Publicado por priscila at 29/05/10 17:33:13


Publicado por MARIA at 29/05/10 22:35:46



Publicado por JULIETA FAN NUMERO 1 DE DEMI!!! at 30/05/10 07:07:15

yo voto a demi porque es la mejor del mundo entero aparte soy su fan numero 1!!! tengo todos sus albunes y estoy desesperada para que llege remember december a la argentina!!!

demi porfavor contestame y aca te dejo mi mail!!!

espero que me agreges a tu mail porque yo deseo que en este 2010 vengas a la argentina y poder conocerte!!!!

Publicado por JULIETA at 30/05/10 07:11:53

miley obio 1.00000 veces mejor de hai le sige demi tambien es suuuuuperr linda pero selena... es ano me gusta para nada

Publicado por kar at 30/05/10 12:09:20

Miley,Selena,Demi: me encantan las tres son lo mejor y queria ir al concierto de Demi pero no tenía con quien ir a chile y no he sabido de conciertos de Miley ni de Selena

son mis idolas y quisiera conocerlas en persona con los jonas porsu puesto by

(Ecuador) (Quito)

Publicado por Galilea at 30/05/10 18:01:25

la verdad para ami las 3 son iguales de espesiales pero ami me gusta mas la serie de demi lovato y despues selena gomes y a el ultimo miley cyscus por que les de demi lovato son mas grasiosas
demi lovato,selena gomes y milei circus son super.

Publicado por pato. at 30/05/10 21:25:12

la verdad para ami las 3 son iguales de espesiales pero ami me gusta mas la serie de demi lovato y despues selena gomes y a el ultimo miley cyscus por que les de demi lovato son mas grasiosas
demi lovato,selena gomes y milei circus son super.

Publicado por pato. at 30/05/10 21:26:07

amo a justin bieber lo amo

i love justin bieber es el mejor lo super mega re amo

Publicado por anonimo at 31/05/10 20:28:25

todas en realidad so jeniales pero la mejor es selena gomez mi artista faborita no me pierdo ni un solocapitulo de lo echisero de wuavarli play no me pierdo te deseo lo mejor en este universo sige asi T.Q.M.a todas las quiero me gusta mucho tu musica em mi lacto te tengo de portada y temgo puras imajenes de ti i puras canciones tuyas te de seo lo mejor del mundo OK..... mi nonbre es roxany cedeño OK..... soi tu fanatica numero 1 ok.....

Publicado por roxany cedeño at 01/06/10 12:34:00

la verdad eres la mejor de el universo okkkkk SELENA GOMES

Publicado por roxany at 01/06/10 12:36:18

selena soy tu fan numero 1 me encanata como actuas en los hechiseros de waverly place te quiero un monton chauu bss

Publicado por sabrina at 01/06/10 19:33:04

maili soy tu fan eres la mejor nunca cambies ni tu selena ni menos tu demi son muy buenas actuando gracias son las mejores las quiero mucho son lo maximo bieeeee

Publicado por ana guadalupe moncada tamayo at 01/06/10 21:28:03

maili soy tu fan eres la mejor nunca cambies ni tu selena ni menos tu demi son muy buenas actuando gracias son las mejores las quiero mucho son lo maximo bieeeee

Publicado por ana guadalupe moncada tamayo at 01/06/10 21:30:19

para mi las tres estan muy bonitas y algun dia kisiera conocerlas en persona plis invitenme a donde viven ustedes porfa me llamo tania

Publicado por tania at 02/06/10 09:19:39

yo vote x demi lovato por que... creo q su musics es presiosa como ella y tambien xq soy muy fan de ella y tengo todas sus fotos y cds!!!! ademas la amo muchisimo y quiero decir q es lo maximo!!!!!

Publicado por rocio at 02/06/10 19:10:22

hanna montana es tan hermosa como selena

Publicado por patricia at 02/06/10 20:47:00

para mi desde luego la mejor es miley cyrus pero tamien me wsta selena gomez,demi lovato no es gran kosa y siempre presume de k sta kon le uapo de joe para mi la mejor sin duda es miley y aun me wsta mas si new kancion"cant be tamed"la ekuxo todos los dias me enkanta miley y sigo su seria fool I LOVE MILEY!!!

Publicado por geTEEEEQma.. at 03/06/10 08:17:46

Que me importa la vida de esas ricas y presumidas que se vayan bien a la mierda

Publicado por genaro perez at 03/06/10 14:28:35

miley sos sensacional me encantan tus canciones sos la mas bonita de las tres me encantarias que vinieras a honduras y asi conocerte en persona mi papi ya ha hablado contigo.
soy tu fan #1.

Publicado por dayana at 03/06/10 16:35:10

pues yo pienso que miley crus es ingreida selena gomes es muy linda y no es ingreida y demi lovato tiene las la csra muy bonita y su pelo tanbien un saludo para ustedes

Publicado por leydi dayana rivera at 03/06/10 20:28:48

pues yo pienso que miley crus es ingreida selena gomes es muy linda y no es ingreida y demi lovato tiene las la csra muy bonita y su pelo tanbien un saludo para ustedes

Publicado por leydi dayana rivera at 03/06/10 20:29:55

este ps me gusta la cantada de las 3
pero mas la de hanna montana
sobes soy tu fan # 1

Publicado por karen at 04/06/10 12:43:40

demi lovato es mi idola favorita, demi te qiero mandar salusos ps y saludos a todas ok bye cdtmmmmm.

Publicado por maria angelica santi migo at 04/06/10 18:09:50

osea ovio q demi es la mejor ,ela estan hermosa y una excelente actriz su music me encanta

Publicado por celene torres vasquez at 04/06/10 18:11:56

hello my name is maria
well I think that is demi lovato mejos
ta she is pretty and beautiful dresses and also is an excellent actress
good bye kisses.

Publicado por maria at 04/06/10 18:22:05

bueno miley me cae bien selena y demetria tambien a mo las canciones de las 3 a i por cirto las tres estan muy bonitas ninguna esta fea todas estan pretty ok bye mi correo es espero que me agregen o k me respondan a dios

Publicado por laura yuritzi castro ara at 04/06/10 18:23:15

a mi me gustan las tres y me gustan sus canciones y como las cantan pero se me hace k selena es la mas bonita de las tres y de ahi demi y luego miley pero miley es la que canta mejor de las tres despues demi y al ultimo selena ese es mi punto de vista y no tengo una favorita me gusta la personalidad de las tres por igual

Publicado por maria josé ontiveros at 05/06/10 14:27:26

aaaaah!!! hola miley sos genial como puedo llegar a ser como vos quisiera ser como vos que cantas,bailas y viajas en limusina
sele:quiero subir al esnario con vos y al final del concierto ir en limusina con vos
demi:sos genial como miley quisiera subir al esnario con vos y al final del concierto ir en limusina con vos

Publicado por soledad at 06/06/10 17:13:11

hola chicas me encantan sus voces miley me gusta tu serie ,selena megusta tu serie y demi megusta tu serie tambien y quiero q ustedes tengan mi correo

Publicado por mayra at 06/06/10 19:54:35

mi idola es selena gomez es muy buena cantondo y me gusta como actua en los hechiceros weverly place y es muy buena con los nños

Publicado por jenifer at 07/06/10 13:54:49

en realidad la mas bella es selena gomez y tiene una voz sensacional canta bellas canciones es buena actriz por lo tanto demi tambien son buenas pero miley es buena pero no llega igual que las otras.

Publicado por estefany mojica at 07/06/10 21:51:54

selena y dedemi son las mejores me gusta su actuacion pero miley no lo ase tambien com demi y selena adios chicas soy su fan numero 1.!!!!!

Publicado por dayana at 08/06/10 11:11:28


Publicado por JULIANA at 08/06/10 18:17:34

eres burra selena gomez miley te gana

Publicado por selene at 08/06/10 19:20:09

slena gomez eres perra pero miley te va ganar y demi lovato se va casar con joe jonas y miley con nick jonas

Publicado por selene at 08/06/10 19:30:52

para mi es mejor demi porqe es muy linda hermosa pero tambien miley y selena sson lindas pero es mejor demi

Publicado por maicol at 09/06/10 13:44:34

hola hanna hola selena hola demi son las mejores del mundo chau me llamo celeste las quiero mucho chau besos a todos chau

Publicado por celeste at 09/06/10 14:10:39


sos genial miro tu programa es re bueno me encanta sos hermosa tengo un monton de fotos tullas
TE QUIERO MUCHO me encanta como cantas,bailas y lo mejor te escucho todos los días

Publicado por Martina at 09/06/10 20:10:48

hola selena sos la mejor camila olivan de olavarria

Publicado por camila at 11/06/10 09:06:39

bueno ami me parece q selena gomez es muy hermosa y miley cyrus tambien pero fue dificil decidir y voto por

Publicado por VALERIA at 11/06/10 10:32:04

SeLeNa gOmEz
dEmI lOvAtO
hehehe nO lA tAl MeYlEi CyRuS HEHHEHEH
Y aPaRaTe EsTaN mUxO MaS bOnItAs Qº
mElEy cYrUs

Publicado por FAN 1º DE SELENA GOMEZ Y DEMI LOVATO at 11/06/10 17:23:41

demi lo mejor gracias por hacer este espectacular concierto a ca en chile demi le gana a selena y miley

Publicado por dddd at 12/06/10 17:50:40

hola miley sele y demi las re amo son las mejorade todo el mundo son lo mas las re quiero!!!!!""""""""""""!!!!!"""""""""""""""
tenso todo de ustedes tres las reamo son lo masss son las mejores las tres !!!!!"""""""""""""""!!!!!""""""""""""""

pd:ñson lo maximo I LOVE!!!!""""····::::::::····""""!!!!

Publicado por LUCIA at 13/06/10 00:01:38

demi lovato eres mi idolo "LA MEJOR"

Publicado por VANESSA at 13/06/10 16:20:27

Demi lovato es mucho mas bonita que selena gomez y miley cirus (hanna montana) es lo que yo pienso

Publicado por andrea at 13/06/10 20:05:07

demi y selena las best friend son las mejores

Publicado por diana at 13/06/10 20:27:38

selena tu eres la mejor yo soy shaina soy tu fans y bueno nunca te dejes ganar de demi ni de miley

Publicado por shaina at 13/06/10 21:37:23

megusta mucho hannah montana yo soila fasn numero 1 de ella

Publicado por elva at 14/06/10 08:19:27

Selena sos la mejor de todas te re quiero me encanta tu voz y tu serie de como actuas de alex hasta ya tengo tu album me lo compre el primer día que salio a la venta y ya tengo 44 figuritas pegadas esta re bueno el album sele te amo sos mi idola besis chau... Con Cariño:-) tu fans: Aby...

Publicado por Abigail at 14/06/10 16:35:58

Hola o creo que todas son muy lindas y muy talentosas pero creo ( yo )que selena es para mi la mejor de todas igual me gusta miley y demi

Publicado por CataliNA at 14/06/10 18:44:42

selena y demi van a ganar tu miley nose bueno yo aberigue de ti en internet y no sabes eres muy odiosa y mala gente las amo demi y selena son estupendas

Publicado por Maria at 15/06/10 07:46:01

ovio q todas lo hacen bn pero la mejor es miley te quiero
es lo mas

Publicado por mariyuli at 16/06/10 10:37:36


Publicado por MARIANA at 16/06/10 12:47:23

no c las tres m caen perfecto aunque can enemigaz del alma por joe jonas

Publicado por jessica at 16/06/10 19:50:14


Publicado por Ana at 22/06/10 10:21:33

yo votooo por ovio q por por supues to q a DEMI LOVATO se un monton de cosas sobree ella es la mejor!!!!! luego miley y luego selenaa

selena al ultimo por q se cree la mejor!! ya se es lindaa actua bn pero me cansa por q todos siempre q selen esto selena lo otro selena esto selena aquello !! ahi alguien en el mundo q no nombre a selena gomez?

una amiga y yo creemos q Demi es la mejor!!!!! besoss las adoro

Publicado por Desi at 22/06/10 15:09:55

a mi me gusta tu mùsica yo voto por ti eres la mejor hannah montana tu eres mi faborita

Publicado por yarianeth at 23/06/10 19:24:10

so0y judith miren las 3 soon famosas y bellizimas
pero0 la verdad es qe tu mileyu cyrus eres la qe mas me cai bien de todas y te quiero mucho nunca me pierdo la serie hannah montana eres lo maximo miley bueno te dejo adioz te quiero mucho no lo olvides

estado de mexico

Publicado por judith at 24/06/10 15:45:32

lo que me parece que selena y demi son basura yo votaría por miley osea.

Publicado por madelin at 24/06/10 17:39:54

yo voto por selena gomez y demi pero juana montana me cae gorrrddddaaaaa

Publicado por jennifer at 25/06/10 09:59:00


Publicado por estefani at 25/06/10 12:44:02

hola soy ana maria de colombia y me parese que miley cyrus es la mejor tengo 13 y espero mas adelante ser como ella te quiero mucho y te apresio eres la mejor del mundo... I love
ana maria s.a

Publicado por ana maria saldarriaga at 25/06/10 15:39:34

la mejor es selena gomes y demi pero si tubiera que decidir entre las dos elijo a selena gomez

Publicado por cristina at 25/06/10 17:41:43

selena gomez es lo + tengo unas ganes que venga a la argentina quiero conoser la ya te te adoro muchisimo natasha tam

Publicado por natasha at 25/06/10 21:45:39

para mi la mejor es miley cyrus porque es estupenda mas que demi y selena demy y selena son buena pero no me gustan mas que miley cyrus i love a miley cyrus.

Publicado por ruth miley at 26/06/10 15:05:56

ola selena disen qe yo me paresco a ti pero tu erez + bonita que yo jeje ojala que zipi me rezpondaz y me dez tu numero por que qiero zer tu amiga te admiro!!! te kiero

Publicado por cristina at 26/06/10 22:19:26

hola demi se q nunca se puede cumplir lo te voy a decir yo soy tu mayor fan y megusta todas tus canciones y todo micelular esta llenas de musicas de tu s canciones y espero conocerte en persona me gusta todas tu canciones y igual micuarto esta llenas de imagenes tullas quiero conocerte en persona de verdad para mi eres mi idolo y nunca de go de ver tu series de sunny estre estreñAS nunca de verdad

Publicado por liset arany pech at 27/06/10 14:56:52


Publicado por SOFIA at 28/06/10 13:37:03

selena demy y hanna son las mejores nunca cambien ok ademas las tres estan super guapas

Publicado por sofia at 28/06/10 13:39:29

pienso que las 3 son muy hermosas muy buenas atrices y muy buenas cantantes y por eso las adoro atodas 3

Publicado por mary yuliana ramirez at 28/06/10 16:38:04


Publicado por YOSSARY NICOLL at 28/06/10 18:41:23

hola hanna soy pame te dirè que eres muy explendida

Publicado por pamela gularte at 01/07/10 10:52:27

Hola miley queria saber si esque tu eres amiga de selena gomez tengo9 años y te escucho todo el rato quiesiera que vinieras a chile a dar un concierto ojala que esto te llege ok cata me llamo baai

Publicado por catalina at 01/07/10 11:03:53

hola yo me llamo anabel y las rre kiero a las 2 si queres chatear con migo es mi msn de parte de mis hermanita y de mi prima te mandan muhos besos eee..demy lovato te rre kiero soy tu fan numero 1...mi culple es mañana el 2 de julio te mando muchos besos

Publicado por anabel at 01/07/10 14:03:58



Publicado por TIATIRA at 01/07/10 18:41:32

hola me llamo carlos y ami me encanta miley cyrus hannah montanah es la megor cantante del planeta es decir que yo amo a hannah montanah la amo y la adoro. bye bye

Publicado por carlos at 02/07/10 15:32:53

selena gomez es la mas lida

Publicado por jose at 02/07/10 18:50:43

yo voto por selena gomez es la mejor te quierp selena

Publicado por luzaira at 02/07/10 19:19:08

mi voto es obviamente x demi lovato!!!! es la mejor..!!! cn miley cyrus ..... x qe selena gomez es horrible!" y falsa..!!! , ella no canta de verdad , mientras qe miley cyrus y demi lovato si cantan... y si miley y demi no cantarian de verdad ellas si an echo conciertos.. y muy buenos , en cambio selena a echo algun concierto??? NO!" asi qe no voten por una weona de selena-!!! ·.·

Publicado por vanessa at 03/07/10 18:21:46

mi favorita es selena gomez es mi idola es linda talentosa etc

Publicado por evelyn at 04/07/10 11:30:12

mi favorita es selena gomez es mi idola es linda talentosa etc

Publicado por evelyn at 04/07/10 11:31:35

hola soy maria isabel y voto por miley (hanna montana)
me gusta el progama de hanna mantana
y las canciones eres la mejor hanna montana

Publicado por maria isabel at 04/07/10 18:13:24

hola soy hanna
yo voto por hanna y punto
no sirve para nada werveri place asco

Publicado por hanna isabel at 04/07/10 18:20:13

me encanta demi lovato

Publicado por maria at 05/07/10 17:36:17


Publicado por yesenia urrego borja at 05/07/10 18:46:26

bueno soy majo de Argentina les quiero desir: hannah , demi y selena las quiero mucho por siempre son las mkejores del mundo unas preguntitas
hannah... ¿ es verdad que estas envarasada? demi ...¿ quien te enseño a cantar asi de lindo? seli ...¿enserio odias tanto a yostin?jajajaja las quiero

Publicado por maria jose bertinetti at 06/07/10 20:01:54


soy claudia y la verdad de las 3 me gusta mas Demi es super linda y ademas canta hermoso
y me encanta la pareja que hace con joe los dos juntos son lo mejor del momento y si siguen asi van a llegar muy lejos los quiero mucho

Publicado por claudia marcela rodriguez alvarez at 07/07/10 14:42:58

Hola soy annais y la verdd es k todas son muy wapass, para mi la mas wapa y k canta mejor es selena pork pienso k es la k mejor canta y la mas wapa

Publicado por annais at 08/07/10 10:43:03

hola soy auri y me bustaria decirle a las tres que cantais bn y que solo bosotras estareis juntas buena surte

Publicado por auri_guapa at 08/07/10 16:56:47


Publicado por francia alejamdra at 08/07/10 17:35:43

selena gomez sabias que sos como las otras dos que estas compitiendo son tus mejores amigas y tienen la misma profesion que vos te las nombrare : las tres son actrizes ,las tres so catantes ,las tres saben bailar y las tres salen en el mismo canal a y hay muhas otras cosas que nombrar de ustedes tres que siempre fueron eran y siempre van a ser muy buenas amigas y muy buenas compañeras

Publicado por loana at 09/07/10 11:49:24

eres lo maximo mi idola favoryta 100pre te veo por tv selena te adora lo maximol

Publicado por katy at 10/07/10 15:21:31

SELENA QUINTANOLLA manda x siempre
ahora es selena gomez

Publicado por charito at 10/07/10 19:43:55

Cute Sel Gomez Cute! :D

Publicado por Catalina at 10/07/10 19:50:38

para mi es mejor demi lovato nunca me pierdo la serie y me parese que es una buena cantante.te adoro e buscado en internet y evisto que cumples años el 20 de agosto y quiero decir que yo cumplo tambien un 20 de septiembre.

Publicado por nazareth at 10/07/10 21:24:15

hi demi i'm your biggest fan target,my dream is to sing beautiful i know taxes go to your consert in Colombia but had no money to go,i love you i`m writing this in english so you understand

my mail is hopefully us talk love you

Publicado por diana camila at 12/07/10 15:37:46

mi boto es para maili cyrus por k ella es mira mejor cantante y mi mejor actris de la te le vision por k ella siempre ase reir mucho alas persona y ademas ella es muy grasiosa y por eso es k me gusta maili cyrus y ademas ella es la mejor cantante k yo e escucho pero parese k maili cyrus no tiene muchas fans por k yo beo k selena gomez y deimi lovato son sus mejores cantantes por k maili fu la k llego mas primero pero despues llegaron esas dos lanbona bueno eso era lo k yo keria expresar grasias por escucharme

Publicado por genesis at 13/07/10 14:40:11

hannah eres la mejor cantando como hannah montana y como miley cyrus me gustan muchos tus canciones y la seria de hannah montana y la pelicula esta muy padre al igual k la pelicula llamada la ultima cancion la cancion de when i look at you eres una gran persona soy tu fans numero 1

Publicado por JAZMIN GUADALUPE at 13/07/10 18:19:49

Soy Maria Hilda, Selena eres suuupppeer guay soy tu fan number one y tambien demi os amo y os quiero a las dos . tambien a meyli pero muchisimo mas a
vosotras .recordad soy vuestra mayor fan.Seguimos me encanta sunny entre estrellas y cuando llegastes !hola soy sunny!. y tu selena cuando hicistes el capitulo de sunny entre esrellas y tambien el de hannah montana. y selena me encanta los magos de warvely place que haces travesuras con !maxi macs! a justin.Me encantan las canciones de las dos y juntas .Qe ya sepas español para que de detalle puedas venir a palma de mallorca .soys las number 11111000.Guapisimas beutifels muuuaaaaa me gustaria estar con vosotras. te quiero muchisimo a las dos two.

Publicado por Maria hilda at 14/07/10 12:30:23

Hola.Me llamo Tania y soy de Spain.La que mas me gusta es Selena Gomez.ES LA MEJOR.Es muy guapa, es la mejor actriz y cantante de todo el planeta.I love Selena.

Publicado por Tania at 15/07/10 03:41:54

miley sos lo mas hermosa , te lo digo coomo amiga tuya q SOY x suerte aprendi a hablar y escribir en español .tkm hermosa!¡

Publicado por emili osment at 16/07/10 16:35:19

yo voto por miley cyrus bye

Publicado por denu la loqa at 16/07/10 16:37:15

obio ke por miley o sea hannah montan a y despues selena gomez y asta el final demi lovato mas bonita

Publicado por montse at 18/07/10 02:19:26

obio ke por miley o sea hannah montan a y despues selena gomez y asta el final demi lovato mas bonita

Publicado por montse at 18/07/10 02:20:16

yo obiamente voto por demi lovato ( es la mejor de todas) xd

Publicado por tiare at 19/07/10 12:41:19

hola soy maryam soy fanatica a selena
gomez , a demi lovato y a mayli sayrus pero yo voto por las tres y ma gusta sus canciones las tres son fantasticas y buenas personas no las conosco en persona y se que pueden hacer muchas cosas por los demas gracias por estar anque se un momento conmigo y anque se solo una vez pliz pliz que vengan a nicaragu

Publicado por maryam at 30/07/10 20:34:08

selena la mejor

Publicado por cony at 04/08/10 14:36:44

yo voto por demi por que es mucho mejor que las demas estrellas de holiwood y mas encima es bonita simpatica y soy su fans numero 11111chao hojala que lo puedas entender

Publicado por geraldy godoy at 12/08/10 16:44:42

ola demi lovato es mi favorita es mas hermosa y talentosa q selena y miley
se q vienes a peru con tu elenco de camp rock y espero poder ir para poder verte y escucharte bye besos mua mua.

Publicado por marian at 13/08/10 23:34:25

hola como estan ustedes voten por miley cyrus por k ella es la mejor k las otras chivas alcaguetas verdad okey adios te kiero miley cyrus.

Publicado por claribel at 17/08/10 16:33:54

ola selena
eres muy bonitami idola y sobre todo me gustas y tanbien me gusta los hechiceros soy tu iiiiidddddooooolllllaaaaa te amo tkm soy tu fffffaaaaannnnnsssss

Publicado por paula at 02/09/10 12:09:16

hola si estan leyendo esto selena es muy bonita igual qe miley y demi . no se deben de envidiar ninguna de las tres son iguales de bonitas . y yo creo qe ni siqiera se dan cuenta de eso todos somos iguales tenemos boca , ojos , en fin yo tambien tengo ojos .algunos tenemos imperfecciones no algunos sino todos asta ustedes , espero qe esto les llegue al corason.

Publicado por anali at 11/09/10 21:37:52

demi lovato soy fan numero 1 tuya no me pierdo tus entrevistas tus serie tras de camaras siempre e soñado en conoserte me veo las peliculas camp rock 1 y 2 sunny entre estrellas en todo lo uqe tu sales me las veo porfa llamame 3205107391 mellamo meliza y quisiera prgunterte algo en persona

Publicado por meliza at 20/09/10 19:56:56

hola selena sos lo mas 100empre miro los hechiseros hanna sos re linda te re kiero y demi cantas re bien me re gusto camp rock de fainal jam y mas la parte qe los retaron al concierto shop qeria qe ganaran

Publicado por barby at 26/10/10 13:55:25

soy tu fan hannah montana tqm tu voz no se conpara com ninguna eres la mejor att.anaya besos m facebook es

Publicado por anata at 13/11/10 18:16:34

bueno me gustan las tres por k todas tienen su caracteristicas pero mas me gusta selena por k es linda me gusta como se viste la adoro soy su fan numero uno y tengo mi cuarto lleno de fotos de ella y me gusta su serie siempre juego juegos de ella y averiguo mucho por la internert sobre ella y bueno eso era todo bye besos

Publicado por madeline at 22/01/11 18:09:49

hola: yo me llamo cony y quiero comentar estrellas famosas por mi vista.: maili cirius es alguien al cual yo admiro por su tele serie hanna montana ferever pero sus canciones o las canciones de hanna no son muy buenas.
demi lovato tanbien es alguien al cual yo admiro pero mucho mas qe maili cirius por su programa de televicion y por sus cancionesss, muy bueeenaasssss pero en cambio selena gomez esa si qe es un buena actriz y cantante canciones pero demaciado pero demaciadooooo buenasssss es mi idola la adoroooo
saludoos para selena

Publicado por cony at 25/01/11 12:57:51

hola soy yudith las tres sos geniales pero no se a quien voy a votar por que las quiero o si no voto por las tres...chau besos las quiero muchoo...maley es bonita y canta lindo...selena es muy divertida y canta lindo...demi me hace reir mucho...asi que voy a votar las tres...adios a todos

Publicado por yudith at 13/02/11 15:18:20

SELENA ss la mejor sin duda te kiero mucho a demi tambien las amo a las dos ¡¡¡bss bss bss enormes para las dos

Publicado por mik at 15/02/11 11:52:14

a mi me encanta este juego es super entretenido
y sobretodo por que estan las tres mejores idolas que me gustan a mi po que son selena gomez,maili cayrus,y demi lovato
me encantan pero no entiendo por que la demi lovato se fue a un siquiatra
pobrecita por penas de amor pero selena estuvo excelente selena gomez en el concierto y maili eres super bonita me encanta tu voz es hermosa y esoo es verdad tu voz no se compara con nadie eres mi fans

Publicado por camila canales at 17/02/11 12:27:52

hola yo vote a demi lovato xq divertida

Publicado por yudith at 18/02/11 14:28:57

hola me llamo javiera y en la foto de demi lovato ela sale linda chao

Publicado por javiera at 23/02/11 17:41:25

pues la verdad sales bien soy tu fan y como quisiera conocerte en persona ojala se me cumpliera ese sueño yo soy de obregon tu fan num.1

Publicado por guadalupe at 15/05/11 23:10:41

Agregar comentario


: (obligatorio)


Su comentario deberá ser aprobado antes de ser publicado. Gracias!